ID: 935886362

View in Genome Browser
Species Human (GRCh38)
Location 2:107623847-107623869
Sequence TGGCAGAGTTCAGCTTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935886362_935886365 -4 Left 935886362 2:107623847-107623869 CCACCAGAAGCTGAACTCTGCCA No data
Right 935886365 2:107623866-107623888 GCCACCAACTTGGATGAGTCTGG No data
935886362_935886368 24 Left 935886362 2:107623847-107623869 CCACCAGAAGCTGAACTCTGCCA No data
Right 935886368 2:107623894-107623916 GACTTTCTCAGTCTCCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935886362 Original CRISPR TGGCAGAGTTCAGCTTCTGG TGG (reversed) Intergenic
No off target data available for this crispr