ID: 935891149

View in Genome Browser
Species Human (GRCh38)
Location 2:107679862-107679884
Sequence CTTTATAGGCAGAATGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935891145_935891149 5 Left 935891145 2:107679834-107679856 CCAGAACTCATAACTGATCGTGT No data
Right 935891149 2:107679862-107679884 CTTTATAGGCAGAATGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935891149 Original CRISPR CTTTATAGGCAGAATGAGTA GGG Intergenic
No off target data available for this crispr