ID: 935898099

View in Genome Browser
Species Human (GRCh38)
Location 2:107759477-107759499
Sequence TTCTAACCCCATGAGCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935898097_935898099 3 Left 935898097 2:107759451-107759473 CCAACTAATCAAACAGTTGGAAC No data
Right 935898099 2:107759477-107759499 TTCTAACCCCATGAGCTACAAGG No data
935898094_935898099 26 Left 935898094 2:107759428-107759450 CCACCTTTTCGTTTGTGTTTCAG No data
Right 935898099 2:107759477-107759499 TTCTAACCCCATGAGCTACAAGG No data
935898095_935898099 23 Left 935898095 2:107759431-107759453 CCTTTTCGTTTGTGTTTCAGCCA No data
Right 935898099 2:107759477-107759499 TTCTAACCCCATGAGCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935898099 Original CRISPR TTCTAACCCCATGAGCTACA AGG Intergenic
No off target data available for this crispr