ID: 935901407

View in Genome Browser
Species Human (GRCh38)
Location 2:107797587-107797609
Sequence GTGAAGAGCTAGAATTAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935901407_935901410 6 Left 935901407 2:107797587-107797609 CCATATTAATTCTAGCTCTTCAC No data
Right 935901410 2:107797616-107797638 AAGGGAAGATTGCAGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935901407 Original CRISPR GTGAAGAGCTAGAATTAATA TGG (reversed) Intergenic
No off target data available for this crispr