ID: 935901756

View in Genome Browser
Species Human (GRCh38)
Location 2:107800160-107800182
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935901756_935901762 4 Left 935901756 2:107800160-107800182 CCAGCTTGAGGACCACTGGCACC No data
Right 935901762 2:107800187-107800209 CTCATTGCAACTTTCCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935901756 Original CRISPR GGTGCCAGTGGTCCTCAAGC TGG (reversed) Intergenic
No off target data available for this crispr