ID: 935906154

View in Genome Browser
Species Human (GRCh38)
Location 2:107842230-107842252
Sequence GGTCTTCAAAATCTGCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1207
Summary {0: 7, 1: 1, 2: 6, 3: 95, 4: 1098}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935906154_935906159 5 Left 935906154 2:107842230-107842252 CCAAAATGCAGATTTTGAAGACC 0: 7
1: 1
2: 6
3: 95
4: 1098
Right 935906159 2:107842258-107842280 CAGTGGCAAGTGGATGGTTGAGG 0: 8
1: 0
2: 0
3: 13
4: 235
935906154_935906163 30 Left 935906154 2:107842230-107842252 CCAAAATGCAGATTTTGAAGACC 0: 7
1: 1
2: 6
3: 95
4: 1098
Right 935906163 2:107842283-107842305 GGAGTGGAGGATAACATCACTGG 0: 2
1: 4
2: 3
3: 12
4: 119
935906154_935906160 9 Left 935906154 2:107842230-107842252 CCAAAATGCAGATTTTGAAGACC 0: 7
1: 1
2: 6
3: 95
4: 1098
Right 935906160 2:107842262-107842284 GGCAAGTGGATGGTTGAGGTTGG 0: 7
1: 0
2: 1
3: 22
4: 278
935906154_935906156 -5 Left 935906154 2:107842230-107842252 CCAAAATGCAGATTTTGAAGACC 0: 7
1: 1
2: 6
3: 95
4: 1098
Right 935906156 2:107842248-107842270 AGACCTGTGTCAGTGGCAAGTGG 0: 8
1: 0
2: 0
3: 8
4: 176
935906154_935906162 17 Left 935906154 2:107842230-107842252 CCAAAATGCAGATTTTGAAGACC 0: 7
1: 1
2: 6
3: 95
4: 1098
Right 935906162 2:107842270-107842292 GATGGTTGAGGTTGGAGTGGAGG 0: 2
1: 6
2: 4
3: 54
4: 631
935906154_935906161 14 Left 935906154 2:107842230-107842252 CCAAAATGCAGATTTTGAAGACC 0: 7
1: 1
2: 6
3: 95
4: 1098
Right 935906161 2:107842267-107842289 GTGGATGGTTGAGGTTGGAGTGG 0: 2
1: 1
2: 3
3: 39
4: 494
935906154_935906158 -1 Left 935906154 2:107842230-107842252 CCAAAATGCAGATTTTGAAGACC 0: 7
1: 1
2: 6
3: 95
4: 1098
Right 935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG 0: 8
1: 0
2: 2
3: 29
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935906154 Original CRISPR GGTCTTCAAAATCTGCATTT TGG (reversed) Intronic
900756241 1:4437010-4437032 GGACTTCAACATGTGAATTTTGG - Intergenic
900773702 1:4565715-4565737 GGACTTCAATATGTGAATTTTGG + Intergenic
900853098 1:5159149-5159171 AGTCTTCAACATATGAATTTGGG + Intergenic
901430493 1:9211210-9211232 GGGCTTCAATATATGAATTTGGG + Intergenic
901856077 1:12044923-12044945 GGACTTCCAAATGTGAATTTGGG - Intergenic
902148507 1:14423504-14423526 GGTCTTCAAAAGCTGGGTTCTGG - Intergenic
902149700 1:14433444-14433466 GGGCTTCAACACGTGCATTTTGG - Intergenic
902151199 1:14444902-14444924 GGGCTTCAATATGTGAATTTTGG - Intergenic
902941069 1:19800300-19800322 TGTCTTCAAAATGTGGCTTTGGG - Intergenic
903001489 1:20269312-20269334 GGTCTTCAACATATGAATTTTGG - Intergenic
903553277 1:24173980-24174002 GGTCTTCAACATATGAATTTTGG - Intronic
904434669 1:30486599-30486621 GGGCTTCAACATATGAATTTGGG - Intergenic
905032445 1:34896284-34896306 GGTCATCAAAATCAGAATGTCGG + Intronic
905094672 1:35459303-35459325 GGATTAGAAAATCTGCATTTAGG + Intronic
905206402 1:36345104-36345126 GGTCTTCATATTTTGCATTTGGG - Intronic
905242999 1:36593315-36593337 GATTCTCAACATCTGCATTTGGG + Intergenic
905697466 1:39985860-39985882 GGGCTTCAACATATGAATTTGGG + Intergenic
905954172 1:41978299-41978321 GGGCTTCAACATATGAATTTGGG - Intronic
905957640 1:42012305-42012327 GGGCTTCAACATATGAATTTGGG - Intronic
906012130 1:42537667-42537689 TCTGTTAAAAATCTGCATTTAGG + Intronic
906699236 1:47845676-47845698 GGTGTTTAAAGTCTGCTTTTAGG + Intronic
906736084 1:48129865-48129887 AGTCTTGAAATTATGCATTTTGG + Intergenic
906888336 1:49677676-49677698 GGTCTTCAAAATACTAATTTTGG - Intronic
907360887 1:53913676-53913698 AATCTTCAACATATGCATTTTGG - Intergenic
907563958 1:55417254-55417276 GGACTTCAACATATGAATTTGGG + Intergenic
907640442 1:56183855-56183877 GGGCTTCAACATATGAATTTTGG - Intergenic
907834793 1:58098569-58098591 GGACTTCAACATATGAATTTTGG - Intronic
907862063 1:58363163-58363185 GGGCTTCAATATATGAATTTGGG + Intronic
908271687 1:62428767-62428789 GGGCTTCAACATATGAATTTTGG - Intergenic
908536934 1:65086961-65086983 GGACTTCAACATATGAATTTTGG - Intergenic
908681117 1:66661974-66661996 GATCTTCTAAAACTTCATTTGGG - Intronic
908789987 1:67771567-67771589 GGCTTTCAAACTCTGCTTTTTGG - Intronic
908804278 1:67914088-67914110 GGGCTTCAACATGTGAATTTTGG - Intergenic
909025647 1:70478713-70478735 GGGCTTCAACATATGGATTTTGG + Intergenic
909131538 1:71742889-71742911 GGGCTTCAACATCTGAATTTTGG - Intronic
909278325 1:73717443-73717465 GTTCTAGAAAATTTGCATTTTGG + Intergenic
909454656 1:75837028-75837050 GGACTTCAACATATGAATTTTGG - Intronic
909571958 1:77123838-77123860 AGGCTTCAAAATGTGAATTTTGG - Intronic
909807720 1:79892662-79892684 GGTCTTTAAAATTTACAATTTGG + Intergenic
909870056 1:80728090-80728112 GGGCTTCAAAATATGAATTTTGG + Intergenic
909999011 1:82319352-82319374 AGACTTCAACATATGCATTTTGG + Intergenic
910353320 1:86324829-86324851 GGTGTTCAAAAGCTGAACTTAGG - Intergenic
910783577 1:90969111-90969133 GGGCTTCAACATATGAATTTTGG - Intronic
911119946 1:94286304-94286326 GGGCTTCAACATATGAATTTGGG + Intergenic
911174337 1:94804077-94804099 GGGCTTCAACATATGAATTTGGG + Intergenic
911431965 1:97801066-97801088 GGGCTTCAACATGTGAATTTTGG - Intronic
911697165 1:100902872-100902894 GGACTTCAACATATGAATTTGGG + Intronic
912089995 1:106060439-106060461 GGGCTTCAAAATATGAATATTGG - Intergenic
912164800 1:107030409-107030431 GGGCTTCAACATATGAATTTGGG + Intergenic
912215712 1:107608980-107609002 TGTGTTCACATTCTGCATTTTGG + Intronic
912281017 1:108313641-108313663 GGACTTCAACATATGAATTTTGG + Intergenic
912526693 1:110288659-110288681 GGACTTCAAAATTTGAGTTTGGG + Intergenic
912628477 1:111226481-111226503 GGGCTTCAACATGTACATTTTGG + Intronic
912765637 1:112407608-112407630 GGACTTCAACATATGAATTTTGG + Intronic
912785891 1:112603927-112603949 GGGGTTCAAAATATGAATTTTGG + Intronic
912830118 1:112945321-112945343 GTTCTTCAAAAACAGCATTGTGG - Intronic
913098862 1:115545069-115545091 GGGTTTCAAAATGTGAATTTGGG - Intergenic
913285646 1:117224255-117224277 GGATTTCAACATATGCATTTTGG - Intergenic
913415558 1:118602826-118602848 GGGCTTCAACATATGAATTTTGG - Intergenic
913426165 1:118732444-118732466 GGTGGTCAAAATCTGTGTTTTGG + Intergenic
913490279 1:119373401-119373423 GGTCTTCTGTCTCTGCATTTAGG - Intronic
913677184 1:121151820-121151842 GGGCTTCAACATATGAATTTGGG - Intergenic
914029022 1:143939449-143939471 GGGCTTCAACATATGAATTTGGG - Intergenic
914160429 1:145128501-145128523 GGGCTTCAACATATGAATTTGGG + Intergenic
914398352 1:147291974-147291996 GGGCTTCAATATATGAATTTGGG + Intronic
914465407 1:147923667-147923689 GGGCTTCAACATATGCATTTTGG + Intergenic
915261892 1:154682805-154682827 GGGCTTCAACATATGGATTTGGG - Intergenic
916290844 1:163164707-163164729 GGTCATTAAAATCTGAGTTTGGG - Intronic
916300361 1:163267065-163267087 GGGCTTCAACATATGAATTTGGG - Intronic
916373806 1:164129371-164129393 GGATTTCAAAATATGAATTTGGG + Intergenic
916628055 1:166580863-166580885 TGTTTACAAAATCTCCATTTTGG - Intergenic
916818940 1:168379435-168379457 GGGCTTCAGCATCTGAATTTGGG - Intergenic
917265314 1:173215001-173215023 GGGCTTCAACATATGAATTTGGG - Intergenic
917642097 1:176992861-176992883 GGTCTTCAACATAGGAATTTGGG - Intronic
917742325 1:177972748-177972770 GGTTTTCAACATATGAATTTTGG - Intronic
918034954 1:180859620-180859642 GGTCTACAAATGCTACATTTTGG - Intronic
918272657 1:182917841-182917863 GGACTTCAATATATGAATTTTGG + Intronic
918422880 1:184381919-184381941 GGTGTTTAAAATCTTCCTTTGGG - Intergenic
918448654 1:184638849-184638871 GGACTTCAACATATACATTTTGG - Intergenic
918923638 1:190750174-190750196 GGACTTCAACATATGAATTTTGG - Intergenic
919021427 1:192110544-192110566 GGTCTTCAACATATGAATTTTGG + Intergenic
919044919 1:192439211-192439233 GGGCAGCAAAATCTGCATCTGGG + Intergenic
919147571 1:193655091-193655113 CAGCTTCAAAATCTGCAGTTGGG + Intergenic
919157700 1:193787875-193787897 GGGCTTCAACATTTGAATTTGGG - Intergenic
919881832 1:201906086-201906108 GGTCTCCAAACTCTGCTTCTAGG + Intronic
920040805 1:203094781-203094803 GGGCTTCAACATATGAATTTTGG + Intronic
920248613 1:204607036-204607058 CCTCATTAAAATCTGCATTTTGG + Intergenic
920464487 1:206170335-206170357 GGGCTTCAACATATGAATTTGGG - Intergenic
920539115 1:206764123-206764145 GGGCTTTAAAATATGAATTTTGG + Intergenic
920704000 1:208238774-208238796 AGTCTCAAAAATCTGTATTTAGG + Intronic
920892782 1:210008661-210008683 GATCTTCAAAATCTTCATTTAGG - Intronic
921260778 1:213383577-213383599 GGACTTCAAAATATGAATTTGGG - Intergenic
921312159 1:213855162-213855184 GGGCTTCAACATATGAATTTTGG + Intergenic
921410991 1:214836204-214836226 GGGCTTTAAAATATGAATTTGGG - Intergenic
921511417 1:216035194-216035216 GGACTTCAACATATGAATTTTGG - Intronic
921891809 1:220361120-220361142 GGACTTCAACATATGAATTTAGG - Intergenic
921968626 1:221120281-221120303 GGGCTTCAACATATGAATTTTGG + Intergenic
922348590 1:224717446-224717468 GGACTTCAATATATGAATTTAGG + Intronic
922569715 1:226627007-226627029 GGGCTTCAACATTTGAATTTGGG - Intergenic
922708465 1:227806745-227806767 GGATTTCAACATCTGAATTTGGG - Intergenic
922732976 1:227961630-227961652 GGACTTCAACATATGGATTTTGG - Intergenic
922811799 1:228420073-228420095 GGATTTCAAAATGTGAATTTTGG - Intergenic
922849437 1:228720402-228720424 GGACTTCAACATATGAATTTTGG - Intergenic
923131254 1:231076740-231076762 GGACTTCAACATGTGGATTTAGG - Intergenic
923560514 1:235036813-235036835 GGGCTTCAACATATGAATTTGGG - Intergenic
923907418 1:238400791-238400813 TGTCTTCAAAATCAGTAGTTGGG + Intergenic
924246555 1:242091242-242091264 GGACTTCAACATATGAATTTTGG + Intronic
924326398 1:242898692-242898714 GGACTTCTACATATGCATTTTGG + Intergenic
924748095 1:246857571-246857593 GATCTTTAACATCTCCATTTTGG - Intronic
1062771059 10:101408-101430 GGGCTTCAAGATATGAATTTTGG - Intergenic
1062921079 10:1280231-1280253 GGGCTTCAACATATGAATTTCGG + Intronic
1063256344 10:4331415-4331437 GCTATTCAAAAGCTGCAGTTGGG - Intergenic
1063694725 10:8322854-8322876 GGTATCCAAATTCTGCATTAAGG + Intergenic
1064491738 10:15865161-15865183 GGGCTTCAATATATGGATTTTGG - Intergenic
1064575371 10:16739909-16739931 TGTCTTAAAAATGTACATTTTGG - Intronic
1064623926 10:17242687-17242709 GGGCTTCAACATATGAATTTTGG + Intergenic
1064850545 10:19704527-19704549 GGGCTTCAAGATATACATTTGGG + Intronic
1064959989 10:20953127-20953149 GGGCTTCAACATATGAATTTTGG - Intronic
1065052480 10:21810114-21810136 GGGCTTCAACATGTGAATTTGGG + Intronic
1065171543 10:23035330-23035352 GGGCTTCAACATATGAATTTGGG + Intronic
1065308692 10:24393561-24393583 GGACTTCAACATATGAATTTGGG - Intronic
1065662996 10:28025610-28025632 GGACTTCAACATCTGAATTTAGG + Intergenic
1066232587 10:33451305-33451327 AGTTTTCAACATATGCATTTTGG + Intergenic
1066452704 10:35545640-35545662 GGACTTCAACATATGCATTTTGG + Intronic
1067074209 10:43164488-43164510 GGTCTCCAGACTGTGCATTTTGG + Intronic
1067363437 10:45602468-45602490 GGACTTCAACATATGAATTTTGG - Intergenic
1067534707 10:47100510-47100532 AGATTTCAACATCTGCATTTTGG - Intergenic
1067549816 10:47226382-47226404 GGGCTTCAACATATGGATTTGGG + Intergenic
1068567454 10:58591606-58591628 GGTTTTCAACATATGAATTTTGG + Intronic
1068650935 10:59521962-59521984 GGGCTTCAACATATGAATTTTGG - Intergenic
1068660085 10:59614592-59614614 GGATTTCAACATATGCATTTGGG + Intergenic
1068790502 10:61025553-61025575 GGTATTCAACATATGAATTTTGG + Intergenic
1069328498 10:67261398-67261420 GGTCTTCAAAAACAACATTTGGG + Intronic
1069795220 10:71047534-71047556 GGATTTCAACATATGCATTTTGG - Intergenic
1070215502 10:74375521-74375543 TGTCTTCACAATCAGCATTTTGG + Intronic
1070516824 10:77215704-77215726 GGGCTTCAACATATGAATTTTGG - Intronic
1070932032 10:80267818-80267840 GGATTTCAACATCTGAATTTGGG - Intergenic
1071110551 10:82150233-82150255 GGTCTTCAACACCTGCAAATGGG - Intronic
1071250433 10:83813296-83813318 GGGATTCAAAACCTGCATATTGG + Intergenic
1071401959 10:85281654-85281676 GGTTTTCAAAATATGAAATTTGG + Intergenic
1071413018 10:85415179-85415201 GGGCTTCAACATATGAATTTGGG + Intergenic
1072200529 10:93153963-93153985 GGGCTTCAACATATGAATTTTGG + Intergenic
1072779725 10:98239993-98240015 GGTCTTTAAAATGTGGTTTTAGG - Intronic
1073469086 10:103711726-103711748 GGTCTCCAAAACCTGGAGTTTGG + Intronic
1073479394 10:103776883-103776905 GGACTTCAATATATGAATTTTGG + Intronic
1074005642 10:109420294-109420316 GGTTTTCAACATATGAATTTTGG + Intergenic
1074014719 10:109522433-109522455 GGTTTTCAACATATGAATTTTGG + Intergenic
1074148317 10:110736775-110736797 AGGTTTCAAAATATGCATTTTGG - Intronic
1074420381 10:113303574-113303596 AGACTTCAACATCTGAATTTTGG + Intergenic
1074632779 10:115276284-115276306 GGGTTTCAAAATATGAATTTTGG + Intronic
1074761865 10:116672997-116673019 GCTGTTTAAAATCTGCATATTGG + Exonic
1074955844 10:118388472-118388494 GGGCTTCAACATATGGATTTTGG - Intergenic
1075077128 10:119359043-119359065 GGGCTTCAACATATGAATTTGGG + Intronic
1075176906 10:120172768-120172790 GTTCTTCTAATTTTGCATTTTGG + Intergenic
1075263987 10:120985277-120985299 GGACTTCAACATCTAAATTTGGG + Intergenic
1075317763 10:121466122-121466144 GGACTTCAACATATGAATTTTGG - Intergenic
1075998707 10:126898133-126898155 GGACTTTAACATATGCATTTTGG + Intergenic
1076145996 10:128122438-128122460 GGAATTCAAAATATGAATTTCGG + Intronic
1076222634 10:128746888-128746910 GTTCTCCAAAATCTTCCTTTTGG + Intergenic
1076464615 10:130670388-130670410 GGGCTTCAAAACATGAATTTTGG - Intergenic
1076557344 10:131335884-131335906 GGGCTTCAACATATGTATTTTGG - Intergenic
1076657564 10:132035174-132035196 GGCCTTCAAAATATGAATTTTGG - Intergenic
1077478361 11:2801659-2801681 GGGCTTCAACATGTGAATTTAGG + Intronic
1077720951 11:4627921-4627943 AGTCTTCAAAATATACCTTTTGG + Intergenic
1078555885 11:12325785-12325807 GGGCTTCAACATATGCATTTGGG + Intronic
1078828924 11:14960265-14960287 GGTCTTCAACATATAAATTTGGG + Intronic
1078828932 11:14960304-14960326 GGTCTTCAACATATAAATTTGGG + Intronic
1078850075 11:15155720-15155742 AGTCTTCAAATTCTGGAATTTGG - Intronic
1079284935 11:19119998-19120020 GGTTTTCTAAATCTTGATTTTGG + Intronic
1079301525 11:19283268-19283290 GGGCTTCAATATATGAATTTTGG + Intergenic
1079328929 11:19518095-19518117 GGGCTTCAATTTCTTCATTTGGG + Intronic
1079878244 11:25888328-25888350 GGACTTCAAAATATAAATTTTGG - Intergenic
1079976150 11:27093900-27093922 GGGCTTCAACATATGAATTTGGG + Intronic
1080021790 11:27569323-27569345 GGGCTTCAACATATGAATTTTGG + Intergenic
1080196698 11:29618795-29618817 GGGCTTCAGTATCTGAATTTGGG + Intergenic
1080231756 11:30024184-30024206 GGGCTTCAACATATGGATTTTGG - Intergenic
1080688427 11:34535102-34535124 GGGCTTCAATATATGAATTTTGG + Intergenic
1080750585 11:35146802-35146824 TGTTTTCAAAAACTTCATTTGGG + Intronic
1081429930 11:42965802-42965824 GGTATTCCAAATCTGCCTTTAGG - Intergenic
1081480915 11:43488029-43488051 GGACTTAAAAATATGAATTTTGG + Intronic
1082093953 11:48111816-48111838 GGACTTCAACATATGAATTTGGG + Intronic
1082258700 11:50061149-50061171 GCTCTTCAAAATCAACATCTTGG - Intergenic
1082781036 11:57287550-57287572 GGACTTCAACATATGAATTTTGG - Intergenic
1082965013 11:58958253-58958275 GGACTTCAACATATGAATTTGGG + Intronic
1082973872 11:59053045-59053067 GGTCTTCAACATATGAATTTGGG + Intergenic
1082978279 11:59096859-59096881 GGTCTTCAACATATGAATTTGGG + Intergenic
1083858888 11:65408908-65408930 CCTCTTCAAAATCAGCATATCGG - Intronic
1084297441 11:68222060-68222082 GGACTTCAACATATGAATTTGGG + Intergenic
1084509110 11:69592110-69592132 GGACTTCAACATGTTCATTTTGG - Intergenic
1084714426 11:70864611-70864633 GGACTTCAACATATGAATTTGGG - Intronic
1084779832 11:71400782-71400804 AGACTTCAAAATATGAATTTTGG - Intergenic
1086157773 11:83686845-83686867 GGACTTCAACATGTGAATTTTGG - Intronic
1086339788 11:85837189-85837211 GGGCTTCAACATATGAATTTGGG - Intergenic
1086606526 11:88702647-88702669 GGGCTTCAACATATGAATTTTGG - Intronic
1086738695 11:90340205-90340227 GGACTTAAACATATGCATTTTGG + Intergenic
1086977002 11:93143522-93143544 GGTCTACAAAATATGCTTCTGGG - Intergenic
1087356771 11:97103509-97103531 GGCCTTCAACATGTGAATTTTGG - Intergenic
1087422487 11:97947901-97947923 AGGTTTCAAAATATGCATTTGGG + Intergenic
1087429712 11:98037221-98037243 AGAATTCAAAATCTGCATTTAGG + Intergenic
1087590811 11:100185610-100185632 GGGCTTCAACATATGCATTTTGG - Intronic
1087779866 11:102290690-102290712 GGCCTTCAACATATGAATTTTGG + Intergenic
1087791169 11:102407480-102407502 GGACTTCAAAGTATGAATTTGGG - Intronic
1087923155 11:103890138-103890160 GGGCTTCAACATATGAATTTGGG - Intergenic
1087965360 11:104406177-104406199 GGTATTCAAACTCTCCATCTTGG - Intergenic
1088096657 11:106108377-106108399 GGACTTCAACATATGAATTTGGG + Intergenic
1088127608 11:106447814-106447836 GGTCTGGAACAGCTGCATTTAGG + Intergenic
1088252344 11:107871864-107871886 GGACTTCAACATATGAATTTTGG - Intronic
1088701910 11:112420772-112420794 AGTCTTCCAAGTCTGCACTTGGG - Intergenic
1089079837 11:115766445-115766467 GGTCCTGGAAATCTGCATTAAGG - Intergenic
1089668762 11:120037542-120037564 GGGCTTCAATATATGAATTTAGG - Intergenic
1089669199 11:120040741-120040763 GGGCTTCAACATATGAATTTGGG - Intergenic
1089725343 11:120472953-120472975 GGCATTTAAAATCTCCATTTTGG - Intronic
1089900645 11:121979969-121979991 GGGCTTCAATATTTGAATTTTGG + Intergenic
1090661837 11:128887960-128887982 GGGCTTCAACATCTGAATTTGGG + Intergenic
1090819935 11:130332775-130332797 AGAATTCAAAATCTGCTTTTGGG + Intergenic
1090827064 11:130395119-130395141 GGGCTTCAACATATGAATTTTGG - Intergenic
1090876693 11:130796386-130796408 GGTCTTCAACATATAAATTTGGG - Intergenic
1091039419 11:132262685-132262707 GGTCTTCAACATAGGAATTTTGG + Intronic
1091137504 11:133205209-133205231 GCTCTTCAAACCCTGCCTTTTGG - Intronic
1091254240 11:134169703-134169725 GGCATTGAAAATCTTCATTTTGG - Intronic
1091497332 12:983894-983916 GGGCTTCAACATATGAATTTTGG + Intronic
1092031680 12:5291545-5291567 GGACTTCAACCTCTGAATTTTGG - Intergenic
1092570711 12:9718551-9718573 GGACTTCAAAATATGAATTTTGG - Intronic
1092751671 12:11724969-11724991 GGTTCTCCAAATTTGCATTTGGG + Intronic
1092779764 12:11974667-11974689 GGACTTCAACATGTGAATTTGGG + Intergenic
1093135699 12:15447694-15447716 GCTCTTAAAAATTTGCTTTTTGG - Intronic
1093301872 12:17468841-17468863 GGTCTTCAACATATGGATTTTGG + Intergenic
1093334583 12:17886957-17886979 GTTCTTCAAAATCTTCACTTGGG + Intergenic
1093394994 12:18670086-18670108 GGGCTTCAAAATATGAATTTGGG + Intergenic
1093881009 12:24404786-24404808 GGGCTTCAACATATGAATTTGGG - Intergenic
1094057966 12:26285779-26285801 GGGCTTCAACATATGAATTTGGG - Intronic
1094444678 12:30516690-30516712 GGGCTTCAACATATGAATTTGGG + Intergenic
1094471455 12:30805203-30805225 GGACTTCATTATCAGCATTTTGG + Intergenic
1094649111 12:32357887-32357909 GGGCTTCAATATATGAATTTAGG + Intronic
1094755250 12:33461494-33461516 GGATTTCAAAATATGAATTTTGG + Intergenic
1095401303 12:41817656-41817678 GGGCTTCAATATATGAATTTTGG - Intergenic
1095618968 12:44226567-44226589 GGACTTCAACATGTGAATTTGGG - Intronic
1097027389 12:56067298-56067320 GGACTTCAACATATGAATTTTGG - Intergenic
1097442608 12:59629240-59629262 GGCCTTAAAAATATGAATTTTGG + Intronic
1097708532 12:62893860-62893882 GGACTTCAACATATGAATTTTGG + Intronic
1097750572 12:63347938-63347960 GGGCTTCAACATATGTATTTTGG - Intergenic
1097786588 12:63766727-63766749 AGTTTTTAAAAACTGCATTTTGG + Intergenic
1097863216 12:64538425-64538447 GGACTTCAACATCTGAAATTTGG + Intergenic
1097907521 12:64935700-64935722 GGGCTTCAACATATGAATTTTGG + Intergenic
1098028371 12:66229984-66230006 CTTCTTCAAACTCTGCATTCAGG - Intronic
1098176681 12:67799399-67799421 GGGCTTCAACATATGAATTTTGG - Intergenic
1098308011 12:69120709-69120731 GGACTTCAACATATGAATTTTGG + Intergenic
1098336430 12:69409703-69409725 GGACTTCAACATATGTATTTTGG - Intergenic
1098339035 12:69432630-69432652 GGACTTCAACATATGAATTTGGG + Intergenic
1098448957 12:70597235-70597257 GGTTTTTAAAATCTCAATTTTGG + Intronic
1098547387 12:71726932-71726954 GGGCTTCAACATATGGATTTTGG - Intergenic
1098605939 12:72389742-72389764 GGTCTTCAGCATGTGCATTTTGG + Intronic
1098664624 12:73146668-73146690 GGACTTCATCATATGCATTTCGG + Intergenic
1098769219 12:74532437-74532459 AGTTTTCAAAATTTGCATTTAGG - Intergenic
1098992404 12:77078304-77078326 GGGCTTCAACATATGAATTTTGG - Intergenic
1099118424 12:78656890-78656912 GGACTTCAACATATGAATTTAGG - Intergenic
1099122694 12:78711628-78711650 GGACTTCAACATATGAATTTGGG + Intergenic
1099303076 12:80921697-80921719 GGGCTTCAACATATGCATTTTGG + Intronic
1099454022 12:82842952-82842974 GGACTTCAACATATGAATTTGGG + Intronic
1099661703 12:85571930-85571952 GGACTTCAATATATGAATTTGGG - Intergenic
1099893211 12:88614255-88614277 GGTTTTCAACATATGAATTTTGG + Intergenic
1100303382 12:93328148-93328170 GGACTTCAACATATGGATTTTGG - Intergenic
1100365067 12:93912789-93912811 GGGCTTCAATATATGAATTTGGG - Intergenic
1100432462 12:94542866-94542888 GGACTTCAACATGTGAATTTTGG - Intergenic
1100434084 12:94555605-94555627 GGGCTTCAACATATGAATTTTGG + Intergenic
1100471425 12:94896778-94896800 GGGCTTCAACATATGAATTTAGG - Intergenic
1100593588 12:96052477-96052499 GGGCTTCAATATATGAATTTGGG - Intergenic
1100605705 12:96150401-96150423 GGGCTTCAACATATGAATTTTGG + Intergenic
1100631645 12:96395642-96395664 GGACTTCAACATGTGAATTTTGG - Intronic
1100685578 12:96983440-96983462 GGGCTTCAATATATGAATTTGGG - Intergenic
1100867421 12:98872171-98872193 GGGCTTCAACATATGAATTTGGG - Intronic
1101296822 12:103432618-103432640 GGACTTCAAAGTGTGAATTTGGG - Intronic
1101312975 12:103600589-103600611 GGGCTTCAACATATGAATTTAGG + Intronic
1101322786 12:103687865-103687887 GTTCTTCCAAATCAGAATTTAGG - Intronic
1101696976 12:107135764-107135786 GGGCTTCAACATGTGAATTTTGG + Intergenic
1101743773 12:107522240-107522262 GGGCTTCAACATATGGATTTGGG + Intronic
1101932640 12:109027049-109027071 GGGCTTCAACATATACATTTGGG + Intronic
1102403305 12:112650006-112650028 GGACTTCAACATGTGAATTTTGG + Intronic
1102476040 12:113189172-113189194 GGGCTTCAACATATGAATTTGGG + Intronic
1102499836 12:113344383-113344405 GGGTTTCAACACCTGCATTTTGG - Intronic
1103128614 12:118446904-118446926 GGACTTCAACATGTGAATTTTGG + Intergenic
1103162034 12:118737314-118737336 GGGCTTCAACATATGAATTTGGG - Intergenic
1103196708 12:119049984-119050006 GGACTTCAATATATGAATTTTGG + Intronic
1104170463 12:126275553-126275575 TTGCTTCAAAATCTGCTTTTGGG - Intergenic
1104707384 12:130957670-130957692 GTTCTTCCAAGTCTGGATTTAGG + Intronic
1104871223 12:131998008-131998030 GGCTTTCCAAATATGCATTTTGG - Intronic
1105717327 13:23080537-23080559 TGTATTCAAAATCTCCATGTTGG - Intergenic
1105903519 13:24780425-24780447 GGACTTCAGTATCTGAATTTGGG + Intronic
1106047789 13:26161023-26161045 GGGCTTCAACATTTGCATTTTGG + Intronic
1106229157 13:27808434-27808456 GGGCTTCAACATATGAATTTGGG - Intergenic
1106482551 13:30147765-30147787 GGACTTCAACATATCCATTTTGG - Intergenic
1106681385 13:32011945-32011967 GGACTTCAACATATGGATTTGGG + Intergenic
1106856533 13:33859863-33859885 GGGCTTCAACATATGAATTTGGG - Intronic
1106953645 13:34912031-34912053 GGGCTTCAACATATGAATTTGGG + Intergenic
1107013869 13:35693894-35693916 GGACTTCAAAATATTAATTTTGG - Intergenic
1107725609 13:43296162-43296184 GGACTTCAACATTTGGATTTGGG - Intronic
1107818149 13:44262618-44262640 GGGCTTCAACATATGAATTTTGG - Intergenic
1107876498 13:44795612-44795634 GGATTTCAAAATATGAATTTTGG - Intergenic
1108076242 13:46682443-46682465 GGACTTCAATATATGAATTTTGG + Intronic
1108207656 13:48106978-48107000 GGGCTTCAACATGTGAATTTGGG - Intergenic
1108276203 13:48812137-48812159 GGACTTCAACATATGAATTTTGG + Intergenic
1108647308 13:52443306-52443328 GGGCTTCAACATATGAATTTGGG - Intronic
1108959045 13:56199501-56199523 TGTATTCAAAATATACATTTAGG + Intergenic
1108961383 13:56236273-56236295 GGACTTCAACATATGAATTTTGG + Intergenic
1109376042 13:61494441-61494463 GGATTTCAAAATATGAATTTTGG + Intergenic
1109379822 13:61544485-61544507 GGATTTCAACATATGCATTTTGG + Intergenic
1109493306 13:63132349-63132371 GGGCTTCAACATATGAATTTCGG - Intergenic
1109754079 13:66736197-66736219 GGGCTTCAACATATGCAATTGGG - Intronic
1110074059 13:71216456-71216478 GGGCTTCAACATATGCATTCTGG - Intergenic
1110161917 13:72388773-72388795 GGATTTCAAAATATGGATTTTGG - Intergenic
1110244861 13:73311303-73311325 GGGCTTCAACATATGAATTTAGG - Intergenic
1110478982 13:75951568-75951590 TGTGTTCAAAATGTACATTTGGG - Intergenic
1110623408 13:77624556-77624578 GGACTTCAACATATGAATTTGGG + Intronic
1110727604 13:78843311-78843333 GGGCTTCAACATATGAATTTTGG + Intergenic
1110738118 13:78962260-78962282 TATCTTTAAAATCTTCATTTTGG - Intergenic
1110750817 13:79113479-79113501 GGACTTCAACATATGAATTTTGG + Intergenic
1110865155 13:80385438-80385460 GGGCTTCAACATGTGGATTTTGG + Intergenic
1110880121 13:80561433-80561455 GGGCTTCAACATATGAATTTTGG - Intergenic
1111826588 13:93275817-93275839 GGGCTTCAACATATGAATTTTGG + Intronic
1111874028 13:93870554-93870576 GGGCTTCAACATATGAATTTAGG - Intronic
1111918762 13:94388885-94388907 GGGCTTCAACATGTGGATTTTGG + Intronic
1111932315 13:94524747-94524769 GGACTTCAACATCTGAAATTTGG - Intergenic
1112043138 13:95568537-95568559 AGCCTTCAGAACCTGCATTTTGG + Intronic
1112122495 13:96428668-96428690 GGACTTCAATATATGAATTTGGG + Intronic
1112286675 13:98111131-98111153 GGGCTCCAAAATATGAATTTTGG + Intergenic
1112364274 13:98743212-98743234 GGGCTTCAACATATGCATTTTGG + Intronic
1112616968 13:101016056-101016078 GGACTTCAATATATGCATTTTGG + Intergenic
1112638138 13:101241233-101241255 GATTTTCAAGACCTGCATTTAGG + Intronic
1112683606 13:101796491-101796513 GGACTTCAATATATGAATTTGGG - Intronic
1112694923 13:101937278-101937300 GGTCTTCAACATATGGAGTTGGG - Intronic
1112795366 13:103050832-103050854 GGACTTCAACATATGAATTTGGG - Intronic
1113157442 13:107339631-107339653 GTTCTCCAAAATGTGCATATGGG - Intronic
1113257478 13:108522936-108522958 GGTCTTCAATATATGAACTTGGG + Intergenic
1113771841 13:112915107-112915129 GTTCATCAAAATCTCCATGTTGG + Intronic
1114766521 14:25377405-25377427 TGTCTTCAACATATGGATTTTGG + Intergenic
1115306515 14:31939140-31939162 GGACTTCAACATATGAATTTGGG - Intergenic
1115922613 14:38393206-38393228 GGACTTTAAAATATGAATTTTGG + Intergenic
1116321884 14:43478558-43478580 GGGCTTCAACATATGAATTTAGG + Intergenic
1117227186 14:53674270-53674292 GGTCTTCAACATATGAATTTTGG - Intergenic
1117960946 14:61160855-61160877 GGGCTTCAAACTATGAATTTGGG - Intergenic
1117993316 14:61456002-61456024 AGTCTTCAAAATTAGCACTTTGG + Intronic
1118405169 14:65415238-65415260 GGTCATAAAAATCTGGTTTTGGG - Intronic
1118652594 14:67913362-67913384 GGTCTTCAAAATGTGATCTTGGG + Intronic
1119144747 14:72301934-72301956 GGACTTCAATATATGAATTTTGG + Intronic
1119174881 14:72561748-72561770 GGTCATCAAACTCTGCCTCTGGG + Intronic
1119658920 14:76436868-76436890 TGTCTTCACACACTGCATTTTGG + Intronic
1119873655 14:78038024-78038046 GGGTTTCAAAATATGAATTTGGG - Intergenic
1119885160 14:78134233-78134255 GAGCTTCAAAATATGGATTTTGG + Intergenic
1120886229 14:89453876-89453898 GGGCTTCAACATCTGAATTTTGG - Intronic
1121177885 14:91904797-91904819 GGGCTTCAACATATGGATTTGGG + Intronic
1121454488 14:94029663-94029685 GGTATTCAACATATGAATTTTGG + Intronic
1121521062 14:94586617-94586639 GGACTTCAGCATATGCATTTTGG + Intronic
1121539654 14:94715613-94715635 GGCCTTCTAGATTTGCATTTCGG - Intergenic
1121566248 14:94911936-94911958 GGGCTTCAACATATGAATTTGGG + Intergenic
1121720819 14:96107501-96107523 GGGCTTCAACATATGAATTTGGG - Intergenic
1122093345 14:99354108-99354130 GGATTTCAACATCTGAATTTGGG + Intergenic
1122192053 14:100053150-100053172 GGGCTTCAACATATGAATTTTGG + Intronic
1122249823 14:100429976-100429998 GGGCTTCAACATATGAATTTTGG + Intronic
1122281847 14:100628209-100628231 GGCCTTCAACATATGAATTTGGG + Intergenic
1122704209 14:103609853-103609875 GGACTTCAACATATGAATTTTGG - Intronic
1122751141 14:103934310-103934332 GGTCTTAAAAATGTGGACTTTGG - Intronic
1122827928 14:104380394-104380416 GGGCTTCAACATATGAATTTGGG + Intergenic
1122965220 14:105120593-105120615 AGACTTCAACATATGCATTTGGG - Intergenic
1123431250 15:20218680-20218702 GTTATTCAAAACCTTCATTTGGG - Intergenic
1123483361 15:20657163-20657185 AGTATTCAAATTCTGTATTTGGG + Intergenic
1123672259 15:22670940-22670962 AGGCTTCAACATATGCATTTTGG + Intergenic
1124080690 15:26492110-26492132 GGGCTTCAACATATGAATTTGGG - Intergenic
1124324306 15:28744231-28744253 AGGCTTCAACATATGCATTTTGG + Intergenic
1124440439 15:29681916-29681938 GGGCTTCAACATATGAATTTGGG + Intergenic
1124505843 15:30272546-30272568 GAACTTCAACATCTGAATTTGGG - Intergenic
1124528190 15:30477272-30477294 AGGCTTCAACATATGCATTTTGG + Intergenic
1124737710 15:32266086-32266108 GAACTTCAACATCTGAATTTGGG + Intergenic
1124770467 15:32530432-32530454 AGGCTTCAACATATGCATTTTGG - Intergenic
1124861525 15:33446710-33446732 GGACTTCAACATATGAATTTTGG + Intronic
1125033586 15:35097504-35097526 GGACTTCAGCATGTGCATTTGGG - Intergenic
1125049466 15:35279819-35279841 GGGCTTCAACATATGAATTTGGG - Intronic
1125063964 15:35459465-35459487 GGGCTTCAACATATGAATTTGGG + Intronic
1125071861 15:35564416-35564438 GGGCTTAAAAATGTGAATTTTGG + Intergenic
1126010273 15:44295852-44295874 GGACTTCAACATGTGAATTTGGG + Intronic
1126334454 15:47570947-47570969 GCTCTCCAAAATATGCATCTAGG + Intronic
1126585923 15:50287375-50287397 GGACTTCAACATGTGAATTTGGG - Intronic
1126675549 15:51156925-51156947 GGGCTTCAACATATGAATTTGGG - Intergenic
1126754817 15:51915882-51915904 GGGCTTCAACATGTGAATTTGGG - Intronic
1126799036 15:52283567-52283589 GGGCTTCAACATATGAATTTGGG - Intronic
1126929254 15:53629769-53629791 AGTCTTGAAAATCAGCAGTTTGG + Intronic
1127304008 15:57684200-57684222 GGATTTCAAAATATGAATTTGGG + Intronic
1127571797 15:60250790-60250812 GGGCTTCAACATGTGAATTTGGG + Intergenic
1127845581 15:62867765-62867787 GGACTTCAATATGTGAATTTTGG - Intergenic
1129063237 15:72878359-72878381 GGACTTCAACATATGAATTTCGG + Intergenic
1130043613 15:80427055-80427077 GGACTTCAACATATGAATTTTGG + Intronic
1130303242 15:82696191-82696213 GAACTTCAACATATGCATTTTGG + Intronic
1130318335 15:82816194-82816216 AGGCTTCAACATATGCATTTTGG + Intronic
1130386578 15:83417310-83417332 GGACTTCAACATATGAATTTGGG + Intergenic
1131561289 15:93443478-93443500 GGACTTCAACATCAGAATTTGGG - Intergenic
1131985231 15:98036521-98036543 GGGCTTCATCATATGCATTTTGG + Intergenic
1132138327 15:99366738-99366760 GGGCTTCAACATATGAATTTAGG + Intronic
1132714459 16:1283879-1283901 GGGCTTCAACATCTGGATTTGGG + Intergenic
1133181037 16:4054865-4054887 GATTTTCAAAATATCCATTTCGG - Intronic
1135137843 16:19898057-19898079 GGGCTTCAACATATGAATTTAGG + Intergenic
1135209228 16:20509946-20509968 GGACCTCAAAATATGAATTTGGG + Intergenic
1135654782 16:24238392-24238414 GGGCTTCAATATCTGAACTTTGG + Intergenic
1135669542 16:24363364-24363386 GGGATTCAACATATGCATTTTGG + Intergenic
1135829632 16:25761961-25761983 GGGCTTCAAACTATGAATTTCGG - Intronic
1136853393 16:33632553-33632575 GTTATTCAAAACCTTCATTTGGG + Intergenic
1138011059 16:53380514-53380536 GGGCTTCAACATATGAATTTTGG - Intergenic
1138640178 16:58379566-58379588 GGGCTTCAAACTATGAATTTAGG - Intronic
1140186079 16:72773644-72773666 GGACTTCAACATCTGAATTTGGG + Intergenic
1140786725 16:78349348-78349370 GGTCTTCAGCATATGAATTTTGG + Intronic
1141687879 16:85580645-85580667 GGGCTTCCACATCTGAATTTGGG - Intergenic
1203114988 16_KI270728v1_random:1480998-1481020 GTTATTCAAAACCTTCATTTGGG + Intergenic
1142926183 17:3239655-3239677 GGTCTTCAAATTCTCTATTGAGG - Intergenic
1143327259 17:6107567-6107589 GGACTTCAACATATGAATTTGGG + Intronic
1143990293 17:10953460-10953482 GAACTTCAAAATATGAATTTTGG + Intergenic
1144000673 17:11051692-11051714 GGATTTCAACATGTGCATTTAGG + Intergenic
1144468562 17:15516682-15516704 GGACTTCAACATATGAATTTGGG + Intronic
1144697835 17:17317355-17317377 GGTTTTTAAAATGTGGATTTGGG + Intronic
1145923803 17:28631079-28631101 GGACTTCAACATATGAATTTGGG - Intronic
1146185828 17:30723608-30723630 GGGCTTCAACCTCTGCATTTGGG - Intergenic
1146461292 17:33047955-33047977 GGGCTTCAATATATGAATTTTGG - Intronic
1146580059 17:34029518-34029540 GGGCTTCAACATATGAATTTTGG - Intronic
1147462157 17:40580025-40580047 GGGCTTTAACATATGCATTTAGG + Intergenic
1147672206 17:42183078-42183100 GGACTTCAACATATGGATTTTGG + Intergenic
1147897854 17:43762937-43762959 GGACTTCAATATATGCATTTGGG + Intergenic
1148167548 17:45493813-45493835 GGGCTTAGGAATCTGCATTTTGG - Intergenic
1148195693 17:45711024-45711046 GGTCTTTAAATTCTGCCTATTGG + Intergenic
1148980545 17:51570754-51570776 GGTTTTCTAAATCTGCAGTTGGG + Intergenic
1148995997 17:51710307-51710329 GGTCTTCAAAAGCTGAAGTTGGG + Intronic
1149270469 17:54971572-54971594 GGGCTTCAACATATGGATTTTGG + Intronic
1149503925 17:57177309-57177331 GGGCTTCAATATATGAATTTGGG - Intergenic
1150398728 17:64840226-64840248 GGGCTTAGGAATCTGCATTTTGG - Intergenic
1150459986 17:65342404-65342426 GGACTTCAAAATATAAATTTTGG + Intergenic
1151359401 17:73579543-73579565 GGACTTCAACATCTGGATTCTGG - Intronic
1151482277 17:74377318-74377340 GGTCTTCAACATATGAATTTGGG + Intergenic
1151643649 17:75414800-75414822 GGGCTTCAACATATGGATTTTGG - Intergenic
1152484309 17:80579762-80579784 GTTCTTAAAAATCTGCATGTGGG + Intronic
1152608388 17:81304072-81304094 GGACTTCAACATGTGAATTTTGG - Intergenic
1153183992 18:2466968-2466990 GGACTTCAACATATGTATTTTGG - Intergenic
1153296265 18:3549819-3549841 GGACTTCAACATATGAATTTAGG - Intronic
1153391622 18:4568432-4568454 GAACTTCAACATCTGAATTTTGG - Intergenic
1153692415 18:7606877-7606899 GATTTTTAAAATCTGCTTTTTGG - Intronic
1154393847 18:13969105-13969127 GGATTTCAATATCTGAATTTGGG + Intergenic
1154462277 18:14604565-14604587 GGTATCCAAAGGCTGCATTTAGG + Intergenic
1155223812 18:23710216-23710238 GGCCTTCAAAACCTTCGTTTTGG + Intronic
1155458250 18:26045192-26045214 GGTTTTCAAAAAATGCCTTTGGG - Intronic
1155938977 18:31784598-31784620 GGACTTCAACATATGAATTTTGG - Intergenic
1156061106 18:33077338-33077360 GGACTTCAACATATGCAATTGGG - Intronic
1156241316 18:35257366-35257388 GGACTTCAACATATGAATTTTGG - Intronic
1156260879 18:35444209-35444231 GGGCTTCAACATATGAATTTTGG + Intronic
1156409306 18:36812448-36812470 GCTCTTCAAACTCTGTCTTTTGG - Intronic
1156670181 18:39459261-39459283 GGGTTTCAATATATGCATTTGGG + Intergenic
1157174910 18:45442663-45442685 GGACTTCAACATATGAATTTTGG + Intronic
1157420599 18:47544718-47544740 GGACTTCAATATATGGATTTTGG + Intergenic
1157596342 18:48866284-48866306 GGATTTCAACATATGCATTTAGG + Intergenic
1158040882 18:53091745-53091767 GGATTTCAACATCTGAATTTTGG + Intronic
1158298196 18:56022597-56022619 GGGCTTCAAAATATGAAATTTGG - Intergenic
1158341709 18:56473270-56473292 GGACTTCAACATATGAATTTTGG + Intergenic
1158360152 18:56663233-56663255 GGGCTTCAACATATGCGTTTTGG + Intronic
1158603158 18:58872188-58872210 AGAATACAAAATCTGCATTTGGG - Intronic
1158797363 18:60863384-60863406 GAGCTTCAACATATGCATTTTGG - Intergenic
1158860904 18:61591585-61591607 GGACTTCAACATATGAATTTTGG - Intergenic
1158929034 18:62302823-62302845 TCTCTTTAAAATCTCCATTTGGG - Intronic
1159361445 18:67409364-67409386 TGTCTTCAAAAAGGGCATTTTGG - Intergenic
1159421039 18:68219869-68219891 GGTGTTTGAAATCTGAATTTTGG + Intergenic
1159544078 18:69817722-69817744 AGGCTTCAACATATGCATTTTGG + Intronic
1159579492 18:70219083-70219105 GGGCTTCAAAATATGAATTTTGG + Intergenic
1159595683 18:70380666-70380688 GGGCTTCAACATATGAATTTTGG + Intergenic
1159609193 18:70507711-70507733 GGACTTCAACATATGAATTTTGG + Intergenic
1159746257 18:72239407-72239429 GGGCTTCAACATATGAATTTTGG + Intergenic
1159799849 18:72884465-72884487 AATATTCAAAATCTGCCTTTTGG + Intergenic
1160013285 18:75122839-75122861 GGACTTCAAAATATGAATTTAGG + Intergenic
1162150767 19:8644035-8644057 GGGCTTCAATACGTGCATTTGGG - Intergenic
1162332401 19:10038410-10038432 GGTCTTCTGACTCTGCCTTTGGG - Intergenic
1162838453 19:13337611-13337633 GGACTTCAACATATGAATTTTGG + Intronic
1162972948 19:14192118-14192140 GGGCTTCAACCTCTGCATTTGGG + Intronic
1165088263 19:33366721-33366743 GGGCTTCAACATATGAATTTGGG - Intergenic
1165190482 19:34058904-34058926 GGGCTTCAATATATGCATTTTGG - Intergenic
1166269716 19:41706622-41706644 GGTGACAAAAATCTGCATTTGGG + Intronic
1166433060 19:42742408-42742430 GGTGACAAAAATCTGCATTTGGG - Intronic
1166439484 19:42799269-42799291 GGTTTTTAAATTCTACATTTTGG - Intronic
1166449020 19:42881622-42881644 GGTGACAAAAATCTGCATTTGGG - Intronic
1166457524 19:42954810-42954832 GGTTTTTAAATTCTACATTTTGG - Intronic
1166474468 19:43110037-43110059 GGTTTTTAAATTCTACATTTTGG - Intronic
1166482971 19:43188418-43188440 GGTGACAAAAATCTGCATTTGGG - Intronic
1166485452 19:43207550-43207572 GGTGACAAAAATCTGCATTTGGG - Intergenic
1166557182 19:43708251-43708273 TGTTTTCAAAATCTACATCTTGG - Intergenic
1166662608 19:44657203-44657225 GGTCCTCAAACTCTCCAGTTAGG - Intronic
1166880026 19:45923306-45923328 GGGCTTCAACATATGAATTTGGG - Intergenic
1166968781 19:46548031-46548053 GGGCTTCAACATATGAATTTTGG - Intronic
1167188771 19:47967742-47967764 GGGCTTCAACATATGAATTTTGG + Intergenic
1167651491 19:50732312-50732334 GGGCTCCAAAATATGAATTTTGG + Intergenic
1167759435 19:51435857-51435879 GGGCTTCAACATATGAATTTTGG + Intergenic
1168523159 19:57068750-57068772 GGACTTCAATATATGCATCTTGG + Intergenic
1168682116 19:58323580-58323602 GGACTTCAATATATGAATTTTGG - Intergenic
925067614 2:940705-940727 GGGCTTCAACATATGAATTTGGG + Intergenic
925336318 2:3101646-3101668 AGACTTCAACATATGCATTTTGG - Intergenic
925767760 2:7253485-7253507 GGTCTTCCACATATGAATTTGGG - Intergenic
925957949 2:8986646-8986668 GGGCTTCAACATATGAATTTTGG - Intronic
926052811 2:9755600-9755622 GGGCTTCAACATATGGATTTTGG - Intergenic
926273452 2:11385619-11385641 GGGCTTCAACATATGAATTTTGG + Intergenic
926612087 2:14956881-14956903 GGACTTCAACATATGAATTTTGG - Intergenic
926622932 2:15063539-15063561 GGGCTTCAACATATGAATTTTGG - Intergenic
926885598 2:17595594-17595616 GGACTTCAACATATGAATTTGGG - Intronic
927066377 2:19475312-19475334 GGGCTTCAACATATGAATTTGGG - Intergenic
927245869 2:20956792-20956814 GGGCTTCAACATGTGAATTTAGG - Intergenic
927257861 2:21056024-21056046 GGGCTTCAATATATGGATTTTGG + Intergenic
927293660 2:21428690-21428712 GGACTTCAACATCTGAATTTAGG - Intergenic
927370967 2:22354950-22354972 GGGCTTCAACATATGAATTTTGG - Intergenic
927412546 2:22843759-22843781 GGACTTCAACATATGAATTTGGG - Intergenic
928063694 2:28141140-28141162 GGGCTTCAACATGTGGATTTTGG + Intronic
928503296 2:31921053-31921075 GTTCTTCAACATGTGAATTTTGG - Intronic
928538621 2:32263512-32263534 GGGCTTCAACATATGGATTTGGG - Intronic
928632233 2:33205722-33205744 GGGCTTCAACATATGAATTTGGG - Intronic
928739679 2:34335952-34335974 GGACTTCAATATGTGAATTTTGG + Intergenic
928856922 2:35813654-35813676 GGACTTCAACATATGCATTTGGG + Intergenic
929998221 2:46842886-46842908 GGTCTTCAAGATCTCCCTTGCGG + Intronic
930140050 2:47942408-47942430 GGGCTTCAACGTCTGAATTTTGG + Intergenic
930313463 2:49770855-49770877 GGGCTTCAACATATGAATTTTGG - Intergenic
930462756 2:51704139-51704161 GGATTTCAACATATGCATTTTGG + Intergenic
930826578 2:55701607-55701629 GGGCTTCAAAATATGAATTGTGG + Intergenic
930869736 2:56158348-56158370 GGGCTTCAACATATGGATTTGGG + Intergenic
930979610 2:57507300-57507322 GGGCTTCAACATATGAATTTGGG + Intergenic
931121968 2:59229923-59229945 GGACTTCAAAATATGATTTTGGG + Intergenic
931390561 2:61839704-61839726 GGTCCTCAAAATCAGGAGTTGGG + Exonic
931425068 2:62163232-62163254 GGGCTTCAACATATGAATTTAGG + Intergenic
931570621 2:63665570-63665592 GGACTTCAACATGTGAATTTTGG + Intronic
931603736 2:64030768-64030790 GGGCTTCAACATATGAATTTGGG + Intergenic
931939778 2:67239457-67239479 GGGCTTCAACATATGGATTTTGG - Intergenic
931967949 2:67554140-67554162 GGTTTTCAACACATGCATTTGGG + Intergenic
932064517 2:68539582-68539604 GGGCTTCAACATATGAATTTTGG + Intronic
933073304 2:77890026-77890048 GGACTTCAAAATTTATATTTGGG - Intergenic
933094341 2:78159411-78159433 GCTCTTCAACATATGAATTTTGG + Intergenic
933912652 2:86956927-86956949 GGTCTTCAAAATCTGCATTTTGG - Intronic
933912811 2:86958903-86958925 GGTTTTCAAAATCAAAATTTAGG - Intronic
933943632 2:87266039-87266061 GGGCTTCAACATATGCATTTTGG + Intergenic
934010184 2:87810987-87811009 GGTTTTCAAAATCAAAATTTAGG + Intronic
934010342 2:87812963-87812985 GGTCTTCAAAATCTGCATTTTGG + Intronic
934517441 2:94997722-94997744 GGGCTTCAACATATGAATTTGGG - Intergenic
934874090 2:97898371-97898393 GGGCTTCAATATGTGAATTTTGG - Intronic
935247313 2:101230111-101230133 GGACTTTAACATTTGCATTTTGG + Intronic
935578441 2:104734904-104734926 AGACTTCAATATCTGAATTTTGG - Intergenic
935773750 2:106451706-106451728 GGTTTTCAAAATCAAAATTTAGG + Intronic
935773909 2:106453683-106453705 GGTCTTCAAAATCTGCATTTTGG + Intronic
935906154 2:107842230-107842252 GGTCTTCAAAATCTGCATTTTGG - Intronic
935906314 2:107844207-107844229 GGTTTTCAAAATCAAAATTTAGG - Intronic
935992623 2:108734753-108734775 GGTCTTCAAAATCTGTATTTTGG - Intronic
935992777 2:108736725-108736747 GGTTTTCAAAATCAAAATTTAGG - Intronic
936127942 2:109807395-109807417 GGTCTTCAAAATCTGCATTTTGG - Intronic
936128092 2:109809368-109809390 GGTTTTCAAAATCAAAATTTAGG - Intronic
936159825 2:110076475-110076497 GGGCTTCAACATATGAATTTGGG + Intergenic
936184840 2:110294878-110294900 GGGCTTCAACATATGAATTTGGG - Intergenic
936216605 2:110562117-110562139 GGTTTTCAAAATCAAAATTTAGG + Intronic
936216755 2:110564090-110564112 GGTCTTCAAAATCTGCATTTTGG + Intronic
936336589 2:111595540-111595562 GGGCTTCAACATATGCATTTTGG - Intergenic
936425744 2:112416698-112416720 GGTTTTCAAAATCAAAATTTAGG + Intronic
936425894 2:112418671-112418693 GGTCTTCAAAATCTGCATTTTGG + Intronic
936596859 2:113856446-113856468 GGACTTCAACATCTAAATTTGGG - Intergenic
937512955 2:122618842-122618864 GGGCTTCAACATATGAATTTGGG + Intergenic
937621797 2:123996990-123997012 GGGTTTCAAGATATGCATTTAGG - Intergenic
938721352 2:134069809-134069831 GGGCTTCAACATATGAATTTTGG - Intergenic
939174179 2:138730423-138730445 GGACTTCAACATATGAATTTTGG + Intronic
939295990 2:140264625-140264647 GGTCTTCAACATATGAATTCAGG + Intronic
939608487 2:144281544-144281566 GGGCTTCAACATATGAATTTTGG - Intronic
939794811 2:146629752-146629774 GGACTTCAAAATCTATTTTTTGG + Intergenic
940014285 2:149087070-149087092 GGACTTCAACATGTGAATTTTGG + Intronic
940254603 2:151715421-151715443 GGTCTTCAACATATGAATTTGGG - Intronic
940363497 2:152820463-152820485 GGGCTTCAACATATGAATTTTGG + Intergenic
940446292 2:153782071-153782093 GGTCTTCAACATATGAATTTAGG - Intergenic
941836009 2:170021579-170021601 GGACTTCAACATATGAATTTTGG + Intronic
942073093 2:172332834-172332856 GGACTTCAACATATGAATTTGGG - Intergenic
942161015 2:173187131-173187153 GGACATCAGAATCTGCAGTTGGG + Intronic
942555761 2:177170977-177170999 GGGCTTCAAGATATGCATTTTGG - Intergenic
943162261 2:184269554-184269576 GGGCTTCAACATATGAATTTTGG + Intergenic
943162954 2:184279010-184279032 GGGCTTCAACATATACATTTTGG + Intergenic
943180705 2:184537078-184537100 GGCCTTCAACATATGAATTTCGG + Intergenic
943661663 2:190565702-190565724 GGACTTCAACATATGAATTTTGG - Intergenic
943888582 2:193255930-193255952 GGGCTTCAACATTTGAATTTTGG - Intergenic
944174999 2:196819246-196819268 GGTTTTCAAGATATGAATTTGGG - Intergenic
944427324 2:199596994-199597016 GGTCTTCAACATATGAATTTTGG - Intergenic
944638392 2:201696955-201696977 GGGCTTCAACATCTGAATTGGGG - Intronic
944655364 2:201872045-201872067 GGACTTCAACATGTGAATTTTGG + Intronic
945204460 2:207317280-207317302 GGACTTGAAAATCTGCATTATGG - Intergenic
945623914 2:212176257-212176279 GGGCTTCAACATCTGAATTGGGG - Intronic
945649878 2:212543751-212543773 GGACTTCAAGATGTGAATTTGGG + Intergenic
945907158 2:215607080-215607102 GGACTTCAACATATGAATTTTGG + Intergenic
945907409 2:215610500-215610522 GGACTTCAACATATGAATTTTGG + Intergenic
946443693 2:219719491-219719513 GGTTTTCAAAATCTGCAATGAGG + Intergenic
946619359 2:221544696-221544718 GGGCTTCAACATATACATTTTGG - Intronic
946667785 2:222068775-222068797 GGTCTTCAACATATGAATTTTGG + Intergenic
946756124 2:222949555-222949577 GGACTTCAACATATACATTTGGG - Intergenic
947076234 2:226349004-226349026 GGTCTTCAACATATAAATTTCGG - Intergenic
947388961 2:229620704-229620726 GGACTTCAATATATGGATTTTGG - Intronic
947422953 2:229957009-229957031 GGACTTCAAAGTATGTATTTGGG + Intronic
947564145 2:231183279-231183301 GGGCTTCAACATATGAATTTTGG - Intergenic
947999722 2:234557741-234557763 GGGCTTCAACATATGAATTTTGG + Intergenic
948106436 2:235417911-235417933 GGACTTCAATATATGAATTTTGG - Intergenic
948259250 2:236590716-236590738 GGGCTTCAAAATATGAATTTTGG + Intergenic
948307885 2:236963275-236963297 GGACTTCAACATGTGAATTTTGG + Intergenic
1168938080 20:1685276-1685298 GGGCTTCAACACATGCATTTTGG - Intergenic
1169281242 20:4268560-4268582 AGGCTTCAACATATGCATTTTGG + Intergenic
1169752173 20:9005472-9005494 GGTTTTCAACATATGAATTTTGG + Intergenic
1170175458 20:13464127-13464149 GGACTTCAAAATATGCATTTGGG - Intronic
1170226047 20:13992979-13993001 GGGCTTCAACATATGAATTTTGG + Intronic
1170343733 20:15358926-15358948 GGGCTTCAAGATATGAATTTTGG + Intronic
1170800679 20:19587565-19587587 GGCCTTGAAAATCTCCAGTTTGG - Intronic
1170871126 20:20207557-20207579 CTTCTTCAGAATCTGCCTTTAGG + Intronic
1171164882 20:22960898-22960920 GGTTTTCACCATCTGAATTTTGG - Intergenic
1171887106 20:30662753-30662775 TGTCTTTAAAAGCTGCATATAGG - Intergenic
1172141943 20:32729035-32729057 GGGCTTCAATATATGAATTTTGG - Intronic
1172387339 20:34543213-34543235 ATTCTTAAAAATCTGAATTTTGG - Intergenic
1172903595 20:38352223-38352245 GAGCTTCAACATCTGAATTTGGG + Intronic
1172950172 20:38718359-38718381 GGGCTTCAACATATGGATTTGGG + Intergenic
1173190319 20:40870981-40871003 GGGCTTCAACATATGAATTTGGG + Intergenic
1173472670 20:43335881-43335903 GGACTTCAACATATGAATTTGGG + Intergenic
1175238593 20:57529498-57529520 GGACTTCAACATATGAATTTGGG - Intergenic
1175371895 20:58497736-58497758 GGACTTCAACATATGGATTTGGG + Intronic
1175583512 20:60118991-60119013 GGTCCTCAATATGTGGATTTGGG + Intergenic
1175635014 20:60574640-60574662 GGACTTCAACATATGAATTTGGG - Intergenic
1175687481 20:61042076-61042098 GGACTTCAACATATGAATTTGGG - Intergenic
1176698924 21:10019120-10019142 GGGCTTCAAAATTTAAATTTGGG - Intergenic
1176812283 21:13554120-13554142 GGTATCCAAAGGCTGCATTTAGG - Intergenic
1177001715 21:15621198-15621220 GGACTTCAACATATGAATTTTGG + Intergenic
1177064840 21:16417421-16417443 GGACTTCAGCATCTGAATTTGGG + Intergenic
1177095621 21:16828289-16828311 TGTCTTCAACATCTCCACTTAGG + Intergenic
1177148683 21:17432951-17432973 GGGCTTCAACATATGAATTTGGG - Intergenic
1177239032 21:18432391-18432413 GGACTTCAACATGTGTATTTTGG - Intronic
1177383064 21:20370803-20370825 GGACTTCAACATATACATTTTGG - Intergenic
1177483083 21:21719454-21719476 GGACTTCAACATCTGAATTTGGG - Intergenic
1177834648 21:26174569-26174591 GGACTTCAACATATGAATTTGGG + Intergenic
1177834719 21:26175257-26175279 GGGCTTCAACATATGAATTTTGG + Intergenic
1177885375 21:26740270-26740292 GGATTTCAACATCTGAATTTTGG + Intergenic
1178172139 21:30053255-30053277 GGTTTTCAAACTGTGCTTTTTGG - Intergenic
1178256065 21:31053566-31053588 GGGCTTCAACATGTGAATTTGGG - Intergenic
1178343617 21:31806571-31806593 GGACTTCAACATATGAATTTTGG + Intergenic
1178472616 21:32906937-32906959 GGGCTTCAACATGTGAATTTGGG + Intergenic
1178475444 21:32933553-32933575 GGGCTTCAACATATGAATTTTGG - Intergenic
1178596166 21:33954741-33954763 GGGCTTCAACATGTGAATTTTGG + Intergenic
1178738302 21:35172302-35172324 GGGCTTCAAAATATGAATTTGGG - Intronic
1178793037 21:35717899-35717921 GGACTTCAACATGTGGATTTTGG - Intronic
1178821506 21:35979365-35979387 AGGCTTCAACATGTGCATTTTGG - Intronic
1179108390 21:38424035-38424057 GGGCTTCAAAATATGCATTTCGG - Intronic
1179302433 21:40124464-40124486 GGACTTCAACATATGCATTTGGG - Intronic
1179317933 21:40261845-40261867 GGGCTTCAACATATGAATTTTGG - Intronic
1179386833 21:40951391-40951413 GGGCTTCAACATATGAATTTTGG - Intergenic
1179461519 21:41538555-41538577 GGACTTCAACATATGGATTTTGG - Intergenic
1179523841 21:41962712-41962734 GGACTTCAACATGTGGATTTTGG + Intergenic
1180627547 22:17204206-17204228 GGGCTTCAATATTTGAATTTGGG - Intronic
1181677178 22:24463047-24463069 GGACTTCAAAATATAAATTTAGG - Intergenic
1181764745 22:25083411-25083433 GGGCTTCAATATGTGAATTTGGG + Intronic
1182245517 22:28954481-28954503 GGGCTTCAAAATATGACTTTTGG + Intronic
1182510275 22:30814782-30814804 GGACTTCAACATATGGATTTTGG + Intronic
1182788994 22:32933096-32933118 GGACTTCAACATATGAATTTTGG + Intronic
1182940003 22:34267835-34267857 GGGCTTCAACATATGAATTTTGG - Intergenic
1182969341 22:34557787-34557809 GGACTTCAACATATGAATTTTGG + Intergenic
1183017949 22:35005474-35005496 GGACTTCAACATATACATTTTGG - Intergenic
1184134989 22:42542881-42542903 GGGCTTCAACACCTGAATTTGGG + Intergenic
1184406417 22:44303268-44303290 GGACTTCAACATGTGAATTTGGG - Intronic
1184543671 22:45150186-45150208 GGGCTTCAATATATGAATTTTGG - Intergenic
1184543807 22:45151298-45151320 GGACTTCAAAAGATGAATTTTGG + Intergenic
949775394 3:7626796-7626818 GGACTTTAAAATATGAATTTGGG + Intronic
949932551 3:9090271-9090293 GGTCTTCGTAATCGGCATTGTGG - Intronic
949959127 3:9297462-9297484 GGATTTCAACATGTGCATTTTGG - Intronic
950113802 3:10437710-10437732 GGACTTCAACATATGGATTTGGG - Intronic
951680541 3:25290161-25290183 GGTCTTCAACATATAAATTTGGG - Intronic
952006613 3:28848637-28848659 GGTCTTCACAATTTTCATTCTGG + Intergenic
952048480 3:29354183-29354205 TTTCTTCAAACTCTGCAATTAGG + Intronic
952443929 3:33361884-33361906 AGTCTTAAAAATATGCACTTTGG + Intronic
952679907 3:36079360-36079382 GGGCTTCAACATTTGAATTTGGG + Intergenic
952699533 3:36311493-36311515 GGGCTTCAACATGTGAATTTTGG - Intergenic
952736661 3:36697901-36697923 TGTCTTCAGGCTCTGCATTTTGG - Intergenic
953154349 3:40355436-40355458 GGGCTTCAACATATACATTTAGG - Intergenic
953190785 3:40685620-40685642 GGACTTCAAAGTATGAATTTTGG + Intergenic
953298476 3:41747557-41747579 GGGCTTCAACATATGAATTTTGG - Intronic
953393288 3:42546383-42546405 GGACTTCAACATGTGAATTTTGG + Intergenic
953502458 3:43450838-43450860 AGTCCTGAAAAACTGCATTTTGG + Intronic
953616194 3:44492885-44492907 GGGCTTCAACATATGAATTTTGG - Intergenic
953705008 3:45224927-45224949 GGGCTTAAACATCTGCTTTTCGG + Exonic
953719794 3:45345413-45345435 GGGCTTCAACATATGGATTTGGG + Intergenic
954001539 3:47561220-47561242 GGGCTTCAACATATGGATTTTGG - Intergenic
954170655 3:48799444-48799466 GGACTTCAATATATGAATTTGGG + Intronic
954889558 3:53912761-53912783 AGTCTTCAAAAGCTGCATAAGGG - Intergenic
955134674 3:56204799-56204821 TGTTTTCAAAATATGCATCTAGG - Intronic
956006437 3:64783510-64783532 GGGCTTCAACATATGAATTTGGG - Intergenic
956371313 3:68564957-68564979 GGTCTTCAACACATGAATTTGGG + Intergenic
956577645 3:70771443-70771465 GGACTTCAACATATGGATTTTGG - Intergenic
956725656 3:72154691-72154713 GGTCTTCAATATATGAATTTAGG - Intergenic
957017080 3:75079123-75079145 GGACTTGAATATCTGGATTTTGG - Intergenic
957568376 3:81914045-81914067 GGCCTTTAAAATCTTCAGTTTGG + Intergenic
957782183 3:84834021-84834043 GGACTTCAACATATGAATTTTGG - Intergenic
957978560 3:87478516-87478538 GGTATTCAAAATGTGAATGTAGG - Intergenic
958111245 3:89149003-89149025 TGGCTTCAAAATTTGCATTATGG - Intronic
958461301 3:94399729-94399751 GGGCTTCAACATGTACATTTTGG + Intergenic
958681286 3:97335091-97335113 GGTCCTCAACATATGAATTTTGG - Intronic
958893163 3:99802497-99802519 GGACTTCAACATATGCATTTTGG + Intergenic
958950632 3:100411853-100411875 GGGCTTCAACATATGGATTTTGG + Intronic
959018040 3:101158256-101158278 GGGCTTCAATATATGAATTTTGG - Intergenic
959047678 3:101492499-101492521 GGGCTTCAACATATGAATTTTGG - Intronic
959084415 3:101835748-101835770 GGACTTCAACATGTGAATTTTGG + Intronic
959406446 3:105966964-105966986 GGACTTCAACATATACATTTTGG + Intergenic
959513982 3:107245035-107245057 GGCCTTCAACATATGAATTTTGG + Intergenic
959826468 3:110803060-110803082 GGGCTTCAACATATACATTTTGG - Intergenic
960237998 3:115306991-115307013 GGGCTTCAAGATATGGATTTTGG - Intergenic
960742807 3:120853422-120853444 GGACTTCAACATGTGAATTTTGG - Intergenic
960908498 3:122625166-122625188 GGACTTCAACATATGAATTTTGG - Intronic
960960003 3:123063988-123064010 GGACTTCAACATATGAATTTGGG + Intergenic
961322883 3:126090104-126090126 GTTCTCCAAAATCTGGATTGTGG + Intronic
962000408 3:131289371-131289393 GGACTTCAACATATGAATTTGGG + Intronic
962049537 3:131798159-131798181 GGACTTCAACATATGTATTTGGG + Intronic
962166956 3:133059216-133059238 GGTTTTCAACATATGAATTTTGG + Intronic
962169060 3:133081479-133081501 GGGCTTCAACATATGAATTTGGG + Intronic
962282434 3:134062045-134062067 GGACTTCAATGTATGCATTTCGG + Intergenic
962322681 3:134404902-134404924 GGTCTTCAAATTCTGTCCTTCGG + Intergenic
962978754 3:140469194-140469216 GGTTTTCAAAATATGAATTTGGG + Intronic
963127480 3:141828532-141828554 GGACTTCAACATATGAATTTTGG + Intergenic
963296370 3:143550924-143550946 GGACTTCAACATATGAATTTTGG - Intronic
963357823 3:144232480-144232502 GGTCTTCAACATATAAATTTTGG - Intergenic
963507688 3:146207679-146207701 GGACTTCAATATGTGAATTTGGG + Intronic
963575300 3:147053306-147053328 GGGCTTCAACATATGAATTTTGG - Intergenic
963618937 3:147579968-147579990 GGTCTTCACAATATGTGTTTTGG - Intergenic
963713160 3:148770883-148770905 GGGCTTCAACATATGAATTTTGG - Intergenic
963728975 3:148952489-148952511 GGACTTCAATATATGAATTTCGG + Intergenic
963766029 3:149336830-149336852 GAACTTCAACATGTGCATTTAGG - Intergenic
964170068 3:153759280-153759302 GGACTTCAACATATGAATTTAGG - Intergenic
964312409 3:155408744-155408766 GGGCTTCAAGATATGAATTTGGG + Intronic
964736257 3:159921753-159921775 GGCCTTCAATATATGAATTTGGG + Intergenic
964828890 3:160860955-160860977 GGGCTTCAATATATGAATTTTGG + Intronic
965308027 3:167092585-167092607 GGGCTTCAAAATATGAGTTTTGG + Intergenic
965410163 3:168320342-168320364 GGACTTCAACATATGAATTTTGG - Intergenic
965432862 3:168611194-168611216 GGACTTCAAAATGTGAATTTTGG + Intergenic
966077318 3:175953292-175953314 GGGCTTCAACATATGAATTTTGG - Intergenic
966380102 3:179336214-179336236 GGACTTCAACATATGAATTTGGG + Intergenic
966587105 3:181638488-181638510 GGACTTCAACATATGGATTTGGG + Intergenic
967002484 3:185349564-185349586 GGTTTTCAAAAACTGTATTTTGG + Intronic
967481491 3:189978528-189978550 AGTCTTCAATATCTGAATCTTGG + Intronic
967506703 3:190260624-190260646 GGACTTCAATATATGAATTTTGG + Intergenic
967855043 3:194111031-194111053 GGGCTTCAATATATGAATTTTGG - Intergenic
968527249 4:1067188-1067210 GGGCTTCAACATATGAATTTTGG + Intronic
968822955 4:2869539-2869561 GGGCTTCAACATGTGAATTTTGG + Intronic
969097840 4:4747462-4747484 GGACTTCGAAATATGAATTTTGG + Intergenic
969125698 4:4946235-4946257 GGACTTCAACATATGGATTTGGG - Intergenic
970074163 4:12198612-12198634 GGTCTTCAACATATAAATTTGGG - Intergenic
970113816 4:12670296-12670318 GGATTTCAACATGTGCATTTTGG - Intergenic
970291099 4:14573194-14573216 GGACTTCAACATATGAATTTTGG - Intergenic
970748939 4:19334294-19334316 GGTCTTTAATATGTGAATTTTGG - Intergenic
970882759 4:20950951-20950973 GGGCTTCAATATATGAATTTTGG - Intronic
970905624 4:21212825-21212847 GGATTTCAAAATATACATTTTGG + Intronic
970919990 4:21382915-21382937 GGACTTCAACATATGAATTTTGG - Intronic
970996801 4:22277051-22277073 GGACTTCAACATGTGAATTTTGG - Intergenic
971286375 4:25293791-25293813 GGGCTTCAAAATATGAATTTGGG + Intergenic
971362835 4:25952909-25952931 GGGCTTCAACATATGGATTTTGG - Intergenic
971456470 4:26850104-26850126 GGACTTCAACATATGAATTTGGG - Intergenic
971658936 4:29386991-29387013 GGGCTTCAACATATGAATTTTGG + Intergenic
971723771 4:30281998-30282020 TGTCTTCAACATATACATTTTGG - Intergenic
971731470 4:30387413-30387435 GGACTTCAACATATGAATTTTGG + Intergenic
972340514 4:38148815-38148837 GGGCCTGAAAATTTGCATTTTGG + Intergenic
972554844 4:40171521-40171543 GGACTTCAACATATGAATTTTGG - Intergenic
972578536 4:40374483-40374505 GGGCTTCAACATATGAATTTGGG - Intergenic
972611483 4:40659610-40659632 GGTTTTTAAAATTTACATTTGGG + Intergenic
973087313 4:46081698-46081720 AGTCTTCAACATATGAATTTAGG - Intronic
973139674 4:46750959-46750981 GGGCTTCAAATTATGAATTTTGG + Intronic
973161321 4:47020306-47020328 GGTCTTCAACTTATGAATTTGGG + Intronic
973755291 4:54067927-54067949 GGGCTTCAACATATGAATTTGGG - Intronic
973805102 4:54518154-54518176 GGGCTTCAACATATGAATTTTGG - Intergenic
974088840 4:57289459-57289481 GAGCTTCAAAATATGAATTTGGG - Intergenic
974277041 4:59735464-59735486 GGGCTTCAAAATGTGAATTTTGG - Intergenic
974339495 4:60596929-60596951 AGGCTTCAAAATATGAATTTTGG - Intergenic
974390874 4:61265852-61265874 AATCTTCGAAATTTGCATTTTGG + Intronic
974418031 4:61636041-61636063 GGACTTCAACATATGAATTTGGG + Intronic
974595469 4:64009457-64009479 GGTCTTTAAAATATTTATTTGGG - Intergenic
974773675 4:66450729-66450751 GGGCTTCAACATATGAATTTGGG - Intergenic
974921021 4:68239094-68239116 GGGCTTCAACATATGAATTTTGG - Intronic
974930810 4:68358983-68359005 GGGCTTCAACATATGAATTTGGG - Intergenic
975600403 4:76093892-76093914 GGGCTTCAACATATGAATTTTGG - Intronic
976028489 4:80721605-80721627 GGACTTCAACATATGAATTTTGG + Intronic
976153386 4:82115782-82115804 GGACTTCAACCTCTGAATTTGGG - Intergenic
976181375 4:82402381-82402403 TCTCTTCCAAATCTTCATTTCGG + Intergenic
976552824 4:86416041-86416063 GGGCTTCAACGTATGCATTTTGG - Intronic
976713800 4:88101569-88101591 GGGCTTCAACATATGAATTTTGG - Intronic
976820640 4:89202901-89202923 GGACTTCAACATATGAATTTGGG - Intergenic
976934148 4:90607740-90607762 GGACTTCAAAATATAAATTTTGG + Intronic
977008498 4:91603991-91604013 GGGCTTCAACATATGAATTTGGG + Intergenic
977189673 4:93984349-93984371 GGGCTTCAACATATGAATTTGGG - Intergenic
977544545 4:98361798-98361820 AGGTTTAAAAATCTGCATTTAGG - Intronic
977927222 4:102714986-102715008 GGACTTCAACATATGAATTTGGG + Intronic
978025984 4:103874866-103874888 GGGCTTCAACATATGAATTTTGG + Intergenic
978301393 4:107272344-107272366 GGTCTTCAACATAGGAATTTTGG - Intronic
978502920 4:109428257-109428279 GGGCTTCAACATATGGATTTTGG - Intergenic
978968162 4:114768434-114768456 GGACTTCAACATATGTATTTCGG - Intergenic
979104954 4:116672733-116672755 GTTTTTCAAAATCTGTATTCTGG + Intergenic
979344658 4:119572700-119572722 GATCTACAAAATCTGAAATTTGG - Intronic
979484336 4:121253822-121253844 GGATTTCAATATCTGAATTTGGG + Intergenic
979529167 4:121750496-121750518 GGACTTCAACATATGAATTTTGG + Intergenic
980133040 4:128834459-128834481 GGGCTTCAAAGTACGCATTTGGG + Intronic
980371389 4:131878439-131878461 GGGCTTCAAAATTTAAATTTGGG - Intergenic
980447475 4:132929293-132929315 GGGCTTCAACATATGAATTTTGG + Intergenic
980610903 4:135162293-135162315 GGACTTCAACATATGCATATTGG - Intergenic
980735335 4:136878591-136878613 GGACTTCAAAATACGAATTTGGG - Intergenic
980758734 4:137200140-137200162 GAACTTCAAAATTTACATTTTGG + Intergenic
980996697 4:139785954-139785976 GGACTTCAACATATGAATTTTGG - Intronic
981362253 4:143860830-143860852 GGGCTTCAATATATACATTTTGG - Intergenic
981438118 4:144750110-144750132 GGACTTCAACATATGAATTTGGG + Intergenic
981687902 4:147475513-147475535 GGGCTTCAACATATGAATTTGGG + Intergenic
981740526 4:147996695-147996717 GGGCTTCAACATATGAATTTTGG - Intronic
981748972 4:148075333-148075355 GGACTTCAACATGTGAATTTGGG - Intergenic
981792674 4:148557132-148557154 GGTCTTCATAATATGGACTTTGG - Intergenic
982124335 4:152171446-152171468 GGTCTTCAATATGTGTATTTGGG - Intergenic
982237361 4:153263969-153263991 GGGCTTCAACATATGAATTTGGG + Intronic
982631227 4:157832033-157832055 GGCCTTCAACATATGAATTTTGG - Intergenic
982810641 4:159821591-159821613 GCTTTTAAAGATCTGCATTTAGG + Intergenic
982996386 4:162353076-162353098 GGTCTTCAATATATGAATTTTGG + Intergenic
983194656 4:164793774-164793796 GGGCTTCAGCATCTGAATTTGGG + Intergenic
983498721 4:168475720-168475742 GGGCTTTAAAATATGAATTTTGG - Intronic
983748706 4:171235358-171235380 GGGCTTCAACATATGAATTTGGG + Intergenic
984236836 4:177169281-177169303 GGACTTCAATATATGAATTTTGG + Intergenic
984441841 4:179780762-179780784 GGCCTTCAACATCTCAATTTTGG + Intergenic
984444903 4:179824551-179824573 TTTCATAAAAATCTGCATTTTGG + Intergenic
984717352 4:182938191-182938213 GGGCTTCAACATGTGAATTTTGG + Intergenic
985757280 5:1726468-1726490 GGACGTCAACATATGCATTTGGG - Intergenic
986280823 5:6320996-6321018 GGCCTTCAAAATATGAATTTGGG + Intergenic
986483739 5:8214687-8214709 GGACTTCAACATATGAATTTTGG + Intergenic
986650408 5:9958232-9958254 GGACTTCAACATATGCATTTTGG - Intergenic
986762268 5:10891087-10891109 GGGCTTCAACATATGAATTTTGG - Intergenic
986937717 5:12911485-12911507 AGTCTTCAACTTCTGAATTTTGG - Intergenic
986977694 5:13411713-13411735 GGACTTCAACATATGAATTTTGG - Intergenic
987107712 5:14656801-14656823 GGACTTCAACATATGAATTTTGG + Intergenic
987393366 5:17397791-17397813 GGGCTTCAACATATGAATTTGGG - Intergenic
987689854 5:21252685-21252707 GGACTTCAACATATGCATTTTGG - Intergenic
987749489 5:22020824-22020846 GGGCTTCAACATATGAATTTTGG + Intronic
987840601 5:23218555-23218577 GGCCTTCAACATATGAATTTTGG + Intergenic
987905984 5:24077952-24077974 GGGCTTCAACATATGGATTTGGG - Intronic
988653721 5:33183374-33183396 GGGCTTCAACATATGAATTTTGG + Intergenic
988785183 5:34560146-34560168 GGACTTCAACATATGCATTTAGG + Intergenic
988801421 5:34699640-34699662 GGGCTTCAACATATGGATTTTGG + Intronic
988978400 5:36538637-36538659 CTTCTTCAATATATGCATTTTGG - Intergenic
989183094 5:38597679-38597701 GGTTCTCAACCTCTGCATTTGGG - Intronic
989360828 5:40599527-40599549 GGGCTTCAACATATGAATTTGGG + Intergenic
989381702 5:40815428-40815450 AGTTTTCAACATCTGAATTTTGG - Intergenic
989664855 5:43842110-43842132 GGGCTTCAACATATACATTTTGG + Intergenic
989792504 5:45422531-45422553 GGACTTCAACATATGAATTTTGG + Intronic
989805741 5:45601828-45601850 GGACTTCAACATATGAATTTTGG - Intronic
990102400 5:52207977-52207999 GGACTTCAACATATGAATTTCGG + Intergenic
990203647 5:53405981-53406003 GGACTTCAACATATGAATTTTGG - Intergenic
990650987 5:57899328-57899350 GGACTTCAACATATGAATTTGGG - Intergenic
990716178 5:58639655-58639677 GGGCTTCAATATATGAATTTTGG + Intronic
990730880 5:58807753-58807775 GGGCTTCAACATATGAATTTGGG + Intronic
990744221 5:58942415-58942437 GGATTTCAAAATATGAATTTTGG - Intergenic
990858244 5:60296142-60296164 GGACTTCAACATATGAATTTTGG + Intronic
990973346 5:61534082-61534104 GGGCTTCCAAATGTGAATTTTGG + Intronic
991021761 5:61986854-61986876 GGGCTTCAAAATATGCATTTTGG - Intergenic
991048496 5:62247674-62247696 GTTATTCAAAACCTTCATTTGGG - Intergenic
991570099 5:68044789-68044811 GGACTTCAACATATGAATTTGGG + Intergenic
991621231 5:68547363-68547385 GGACTTCAACATATGAATTTTGG + Intergenic
991644256 5:68785768-68785790 GGGCTTCAACATATGAATTTTGG + Intergenic
992176236 5:74151455-74151477 CATCTTCGAAACCTGCATTTGGG - Intergenic
992255670 5:74918426-74918448 GGGCTTCAATATATGAATTTGGG - Intergenic
992751690 5:79868352-79868374 GGACTTCAACATATGAATTTTGG + Intergenic
992778594 5:80108726-80108748 GGACTTCAACATATGAATTTTGG - Intergenic
993524296 5:88945331-88945353 GGTCTTCCAAAACTGCACTCTGG + Intergenic
993851862 5:93020254-93020276 GGGCTTCAACATATGAATTTGGG + Intergenic
993987168 5:94611211-94611233 GGTCTTAAGAATCTAAATTTAGG - Intronic
994169887 5:96647522-96647544 GGACTTCAACATATTCATTTTGG - Intronic
994251762 5:97544098-97544120 GGTCTTCAACATAGGAATTTGGG - Intergenic
994311650 5:98279000-98279022 GGACTTCAACATATGAATTTTGG + Intergenic
994431112 5:99662430-99662452 TGTATTCAAATTCTGCATTCAGG - Intergenic
994777932 5:104059166-104059188 GGTCTTTATGATCTGTATTTTGG + Intergenic
994812645 5:104541445-104541467 TGTCTTCATAATCTGTATTATGG + Intergenic
994814870 5:104573008-104573030 GAGTTTCAAAATATGCATTTTGG - Intergenic
995153858 5:108885732-108885754 AGTTTTCAACATCTGAATTTTGG + Intronic
995341281 5:111063453-111063475 GGGCTTCAACATTTGAATTTTGG - Intergenic
995413055 5:111879972-111879994 GGGCTTCAACATATGAATTTGGG + Intronic
995535438 5:113131000-113131022 GGGCTTCAATATATGAATTTGGG + Intronic
995904538 5:117107564-117107586 GGACTTCAATATATGAATTTTGG + Intergenic
995921557 5:117320116-117320138 GGACTTCAACATATGAATTTTGG + Intergenic
996050927 5:118932500-118932522 GGACTTCAACATATGAATTTTGG - Intronic
996191975 5:120555677-120555699 GGGCTTCAACATATGAATTTTGG + Intronic
996422177 5:123274761-123274783 GGACTTCAACATGTGAATTTTGG - Intergenic
996475716 5:123918139-123918161 GGGCTTCAACATATGAATTTTGG + Intergenic
996752209 5:126900309-126900331 GGATTTCAAAATATGAATTTTGG - Intronic
997423901 5:133789924-133789946 GGGCTTCAATACATGCATTTTGG + Intergenic
997732114 5:136189250-136189272 GGGCTTCAACATATGAATTTTGG + Intergenic
997806871 5:136926921-136926943 GGGCTTCAACATATGAATTTGGG - Intergenic
997954437 5:138267740-138267762 TGTTATGAAAATCTGCATTTTGG + Intronic
998065570 5:139155608-139155630 GGACTTCAACATATGAATTTTGG + Intronic
998480731 5:142460516-142460538 GGACTTCAACATGTGGATTTTGG + Intergenic
998923919 5:147101410-147101432 GGACTTCAATATATGAATTTTGG + Intergenic
998986399 5:147762706-147762728 GGGCTTCAACATATGAATTTGGG + Intronic
999095400 5:148973568-148973590 AGTCTTCCAAATCTGTAATTTGG + Intronic
999130110 5:149275926-149275948 GGGCTTCAACATATGCATTTGGG + Intronic
999950302 5:156642246-156642268 GGGTTTCAACATCTGAATTTTGG + Intronic
1000165902 5:158648497-158648519 GGACTTCAATATATGGATTTTGG - Intergenic
1000201157 5:159012419-159012441 GGACTTCAACATATGAATTTTGG - Intronic
1000354936 5:160385242-160385264 GGCCTTCAACATATGAATTTGGG + Intergenic
1000929600 5:167235325-167235347 GGACTTCAACATATGAATTTGGG + Intergenic
1000961528 5:167606557-167606579 GGGCTTCAACATATGAATTTGGG + Intronic
1001198240 5:169692986-169693008 GGTATTCAATATATGAATTTGGG + Intronic
1001341748 5:170853161-170853183 GGGCTTCAACATATGAATTTTGG + Intergenic
1001729162 5:173936474-173936496 GGACTTCAACATATGAATTTGGG + Intronic
1001768673 5:174275901-174275923 GGGCTTCAACATATGAATTTGGG + Intergenic
1002758843 6:186178-186200 TGCCTTCAAACTCTACATTTTGG - Intergenic
1002893593 6:1360051-1360073 GATCTGCAAACTCTGCCTTTGGG - Intergenic
1003149088 6:3533556-3533578 GGGCTTCAACATATGAATTTTGG + Intergenic
1003223176 6:4179834-4179856 GGTCTTCAATATATAAATTTGGG - Intergenic
1003243187 6:4362009-4362031 GGGTTTCAACATATGCATTTCGG + Intergenic
1003256267 6:4477686-4477708 GGGCTTCAACATATGAATTTTGG + Intergenic
1003428555 6:6017518-6017540 GGGCTTCAATATATGAATTTTGG - Intergenic
1003497220 6:6674787-6674809 GACTTTCAAAATCTGAATTTAGG - Intergenic
1003519216 6:6843290-6843312 TCTCTTCAAAAACTGCCTTTGGG + Intergenic
1003614130 6:7639952-7639974 GGGCTTCAATATATGAATTTTGG + Intergenic
1003819084 6:9875987-9876009 GGGCTTCAACATATGAATTTTGG - Intronic
1003843382 6:10146549-10146571 GGACTTCAACATATGAATTTTGG + Intronic
1004077724 6:12360264-12360286 GCTCCTTAAAATCTTCATTTTGG + Intergenic
1004307607 6:14515065-14515087 GATCTTTAAACTCTGCATTTAGG + Intergenic
1004358522 6:14950737-14950759 GGGCTTCAACATATGAATTTTGG - Intergenic
1004438742 6:15625495-15625517 ATTCTTCAGAAACTGCATTTTGG - Intronic
1004447094 6:15710368-15710390 GGACTTCAACATGTGAATTTGGG - Intergenic
1004564895 6:16787128-16787150 GGCCTTCAACATATGAATTTGGG - Intergenic
1004604260 6:17179077-17179099 GGGCTTCAACATATGGATTTTGG - Intergenic
1005103894 6:22202827-22202849 GGACTTCAACATATGAATTTTGG - Intergenic
1005106952 6:22233845-22233867 GGGCTTCAACATATGAATTTGGG + Intergenic
1005169390 6:22965171-22965193 GGTCTTCAACATACACATTTGGG - Intergenic
1005190522 6:23216567-23216589 GGGCTTCAACATATGGATTTGGG + Intergenic
1005198109 6:23312622-23312644 GGGCTTCAACATATGAATTTTGG - Intergenic
1005212018 6:23477106-23477128 TGTCTTCAACATATACATTTCGG - Intergenic
1005560082 6:27030742-27030764 GGACTTCAACATGTGAATTTTGG + Intergenic
1005577261 6:27201521-27201543 GGACTTCAGAATATACATTTTGG + Intergenic
1005788373 6:29270611-29270633 GGGCTTCAACATATGAATTTTGG + Intergenic
1005855556 6:29860067-29860089 GGGCTTCAACATGTGGATTTTGG - Intergenic
1005916042 6:30352452-30352474 GGGCTTCAACATATGAATTTTGG - Intergenic
1005997960 6:30942947-30942969 TGTCTTCAAAATCTGCAGAATGG - Intronic
1006585219 6:35106090-35106112 GGGCTTCAACATATGAATTTGGG - Intergenic
1009421747 6:63471752-63471774 GGGCTTCAACATATGAATTTTGG - Intergenic
1009446245 6:63745762-63745784 GGGCTTCAACATATGTATTTGGG - Intronic
1009551724 6:65104483-65104505 ACTTTTCAACATCTGCATTTAGG - Intronic
1009724336 6:67518181-67518203 GGGCTTCAAAATTTAAATTTTGG - Intergenic
1010182739 6:73106727-73106749 GGACTTCAACATATGAATTTTGG + Intronic
1010309669 6:74370294-74370316 GGGCTTCAACATTTGAATTTGGG - Intergenic
1010500887 6:76598815-76598837 CATCTGCAAAATATGCATTTTGG - Intergenic
1010784999 6:79990931-79990953 GGGCTTCAACATATGAATTTTGG - Intergenic
1010890880 6:81308995-81309017 TGTCCTCAAATTCTGCTTTTAGG + Intergenic
1011206555 6:84905399-84905421 GGGCTTCAACATATGAATTTTGG + Intergenic
1011280573 6:85673094-85673116 GGTATTCAAAATATGAATTTTGG + Intergenic
1011345488 6:86365371-86365393 GGACTTCAACATATGGATTTGGG + Intergenic
1011571179 6:88737505-88737527 GGGCTTCAACATATGAATTTGGG - Intronic
1011613447 6:89176383-89176405 GGGCTTCAATATATGAATTTGGG - Intergenic
1011960349 6:93080990-93081012 GGTCTTCAACATATATATTTTGG + Intergenic
1012146091 6:95684033-95684055 AGTCTTCATAATTTGTATTTTGG - Intergenic
1012402064 6:98848876-98848898 GGTCCTAAAGTTCTGCATTTAGG - Intergenic
1012473522 6:99596726-99596748 GGACTTCAACATGTGAATTTTGG + Intergenic
1013223455 6:108101057-108101079 GGACTTCAATATATGAATTTGGG - Intronic
1013320409 6:108982443-108982465 GGGCTTCAACATGTGAATTTTGG + Intergenic
1013538025 6:111081266-111081288 GGGCTTCAACATATGAATTTTGG + Intergenic
1013541959 6:111119641-111119663 GAGCTTCAAAATATGGATTTTGG - Intronic
1014114228 6:117654361-117654383 GGGCTTCAACATATGGATTTTGG + Intergenic
1014143830 6:117973344-117973366 GGACTTCAACATATGGATTTGGG + Intronic
1014318354 6:119894622-119894644 GAGCTTCAACATCTGAATTTGGG + Intergenic
1014993297 6:128109000-128109022 GGGCTTCAACATATGGATTTTGG + Intronic
1015022279 6:128491019-128491041 GGGCTTCAACATATGAATTTTGG + Intronic
1015275596 6:131380636-131380658 GGTCTTCAAGACATGAATTTGGG - Intergenic
1015340137 6:132089777-132089799 GGGCTTCAACATATGGATTTGGG - Intergenic
1015678618 6:135779589-135779611 GGGCTTCAACATATGAATTTTGG + Intergenic
1015680705 6:135804850-135804872 GGGCTTCAACATATGAATTTTGG + Intergenic
1015878722 6:137849628-137849650 GATCTTCTAAAACTGGATTTGGG - Intergenic
1016090255 6:139969294-139969316 GGACTTCAACATATGAATTTTGG + Intergenic
1016090773 6:139976224-139976246 GGACTTCAACATATGAATTTGGG - Intergenic
1016115020 6:140270420-140270442 GGGCTTCAACATATGAATTTTGG - Intergenic
1016301328 6:142635099-142635121 GGCCTTCAACATGTGAATTTGGG + Intergenic
1016358130 6:143239722-143239744 CGTGTTCAAAATGTGGATTTTGG + Intronic
1016733786 6:147453995-147454017 GGACTTCAACATATGCATTTTGG - Intergenic
1016737575 6:147495698-147495720 GGGCTTCAACATATGAATTTTGG + Intergenic
1016810398 6:148255471-148255493 AGCCTTCAAAATATGAATTTGGG + Intergenic
1016859709 6:148705497-148705519 GGACTTCAAAACATGAATTTTGG - Intergenic
1016908294 6:149172722-149172744 GGGCTTCAATATATGAATTTTGG + Intergenic
1016915523 6:149240875-149240897 GGGCTTCAACATATGCATTTAGG - Intronic
1017066399 6:150533172-150533194 GGACTTCAAGATATGAATTTTGG - Intergenic
1017076759 6:150625857-150625879 GGACTTCAACATATGAATTTGGG + Intronic
1017180907 6:151550926-151550948 GGACTTCAAAGTATGAATTTTGG + Intronic
1017205480 6:151800436-151800458 GGGCTTCAATATGTGAATTTGGG - Intronic
1017283914 6:152652611-152652633 GGACTTCAACATATGAATTTAGG + Intergenic
1017615275 6:156240647-156240669 GGCCTTCAACATATGAATTTGGG - Intergenic
1018038437 6:159901254-159901276 GGACTTCAACATATGAATTTTGG + Intergenic
1018383375 6:163280868-163280890 GGACTTCAACATATGAATTTGGG + Intronic
1018677801 6:166237458-166237480 GCTCCCTAAAATCTGCATTTTGG + Intergenic
1018682783 6:166277729-166277751 GGGCTTCAACATGTGAATTTTGG - Intergenic
1018692003 6:166354114-166354136 AGTTTTCAAAATATGAATTTTGG - Intergenic
1018785310 6:167103523-167103545 GGGCTTCAACATATGAATTTTGG - Intergenic
1018832220 6:167451901-167451923 GGGCTTCAACATATGGATTTGGG + Intergenic
1018997514 6:168721411-168721433 GGACTTCAACATATGAATTTTGG - Intergenic
1019788600 7:2995780-2995802 GGGCTTCAACATGTGAATTTGGG + Intronic
1020453372 7:8345457-8345479 GGGCTTCAACATATGAATTTTGG - Intergenic
1020654910 7:10917530-10917552 GGGCTTCAACATATGAATTTTGG - Intergenic
1021093762 7:16511979-16512001 GGATTTCAACATATGCATTTTGG - Intronic
1021152273 7:17166100-17166122 GGGCTTCAATATATGAATTTTGG + Intergenic
1021289317 7:18823562-18823584 GGGCTTCAACATATGAATTTTGG - Intronic
1021432228 7:20573060-20573082 GGACTTCAATATATGAATTTGGG + Intergenic
1021462176 7:20900864-20900886 GGGCTTCAACATTTGAATTTGGG + Intergenic
1021500424 7:21327112-21327134 ATTCTTAAAAATCTGCAATTGGG + Intergenic
1021537451 7:21721740-21721762 GGGCTTCAAAATATGGATTTGGG + Intronic
1021543063 7:21782069-21782091 GGTCTTCAAAATATGAATTTTGG + Intronic
1021594181 7:22296925-22296947 GGACTGAAAAATCAGCATTTTGG + Intronic
1021652394 7:22844821-22844843 GGGCTTCAACCTATGCATTTTGG + Intergenic
1022004833 7:26257742-26257764 AGTCTTCTAACTTTGCATTTTGG - Intergenic
1022022247 7:26412053-26412075 GGGCTTCAACATATGGATTTTGG - Intergenic
1022130820 7:27402740-27402762 GGGCTTCAACATATGAATTTTGG + Intergenic
1022589899 7:31651569-31651591 AGTTTTGAAAATCTGCATTGGGG + Intronic
1022992580 7:35722991-35723013 GGGGTTCAACATATGCATTTTGG + Intergenic
1023483872 7:40663869-40663891 GGACTTCAATATGTGAATTTTGG - Intronic
1023559058 7:41453348-41453370 GGATTTCAACATATGCATTTTGG - Intergenic
1023781450 7:43659810-43659832 GGGCTTCAACATATGAATTTTGG - Intronic
1023941852 7:44773468-44773490 GGTCTTGAACTTCTGGATTTTGG - Intergenic
1024027443 7:45424648-45424670 GGGCTTCAACATATGAATTTTGG + Intergenic
1024248487 7:47488661-47488683 GGACTTCAACATTTGAATTTGGG + Intronic
1024833078 7:53484722-53484744 GGGCTTCAAAATGTGAATTTTGG - Intergenic
1025174954 7:56794661-56794683 GCTCTTCAAAATCAACATCTTGG - Intergenic
1025696849 7:63781754-63781776 GCTCTTCAAAATCAACATCTTGG + Intergenic
1025975553 7:66366802-66366824 GCTCTTCAAAATCAACATCTTGG - Intronic
1027367060 7:77469497-77469519 GGGCTTCAATATATGAATTTTGG - Intergenic
1027528259 7:79298666-79298688 GGACTTCAACATATGAATTTTGG - Intronic
1027531899 7:79345070-79345092 GGACTTCAACATATGCATTTAGG - Intronic
1027748519 7:82110219-82110241 GGGCTTCAACATATGAATTTTGG - Intronic
1027788902 7:82614637-82614659 GGGTTTCAAAATATGAATTTTGG + Intergenic
1028212008 7:88085104-88085126 GGACTTTAACATATGCATTTTGG + Intronic
1028323896 7:89497918-89497940 GGACTTCAACATGTGAATTTTGG - Intergenic
1028361111 7:89967070-89967092 GGTCTTCAAAATATGAATTTTGG + Intergenic
1028720494 7:94025372-94025394 AGTCATCAAAAATTGCATTTTGG + Intergenic
1030170223 7:106593879-106593901 GGTTTTCAAACTGTGCTTTTGGG - Intergenic
1030203471 7:106929196-106929218 GGGTTTCAAAATATGAATTTTGG + Intergenic
1030318362 7:108139361-108139383 GGGCTTCAACATATGAATTTGGG + Intergenic
1030431727 7:109456376-109456398 GGTGCACATAATCTGCATTTTGG - Intergenic
1030479724 7:110087634-110087656 GGACTTCAACATATGAATTTTGG - Intergenic
1030798635 7:113821025-113821047 ATTCTTCAAAATCTGTTTTTAGG + Intergenic
1030901076 7:115124558-115124580 GGGCTTCAACATATGAATTTGGG - Intergenic
1031042594 7:116854553-116854575 ACCCTTCAAAATCAGCATTTTGG + Intronic
1031171672 7:118299377-118299399 GGGCTTGAACATATGCATTTGGG + Intergenic
1031243278 7:119272361-119272383 GGGCTTCAACATTTGAATTTGGG + Intergenic
1031925451 7:127634209-127634231 GGACTTCAACATGTGAATTTTGG + Intergenic
1031938583 7:127762566-127762588 GGTCTTCAACATATGGATTTTGG + Intronic
1032140665 7:129327100-129327122 GGGCTTCAACATATGAATTTGGG - Intronic
1032244365 7:130196537-130196559 GGGCTTCAACATATGAATTTGGG - Intronic
1032420718 7:131776979-131777001 GGACTTCAACATATGAATTTTGG + Intergenic
1032860683 7:135876360-135876382 GGGCTTCAACATATGAATTTTGG - Intergenic
1032896097 7:136252504-136252526 GGATTTCAAAATCTGAATTTTGG - Intergenic
1033044242 7:137947060-137947082 GGGCTTCAACATTTGGATTTCGG - Intronic
1033157059 7:138966124-138966146 GGACTTCAACATGTGAATTTTGG - Intronic
1033380684 7:140815038-140815060 TGTATTCAAAATCTGTATATTGG - Intronic
1033510482 7:142055815-142055837 GGTCATCACATTCTGCTTTTAGG + Intronic
1033513329 7:142082299-142082321 GGTCGTCACATTCTGCTTTTAGG + Intronic
1034104277 7:148477157-148477179 GGGCTTCAACATATGAATTTTGG - Intergenic
1034203752 7:149298480-149298502 GGCCTTCAACATATGAATTTGGG - Intergenic
1034396959 7:150833678-150833700 CGACTTCAACATATGCATTTTGG + Intronic
1034524188 7:151645578-151645600 GGTTTTAAAAAAATGCATTTAGG + Intronic
1034822882 7:154233418-154233440 GGACTTCAACATATGAATTTCGG - Intronic
1034986229 7:155517094-155517116 GGGCTTCAACATATGGATTTTGG - Intronic
1035083301 7:156235353-156235375 GGTCTTCAGAATAAGCATCTGGG - Intergenic
1035920943 8:3675492-3675514 GGGCTTCAACATATGAATTTTGG - Intronic
1036575008 8:10019221-10019243 GGATTTCAACATCTACATTTTGG + Intergenic
1036579499 8:10060701-10060723 TGTAATCAAAATCTACATTTTGG + Intronic
1036718447 8:11149085-11149107 GGCTTTCAACATCTGAATTTTGG - Intronic
1036998467 8:13688384-13688406 GGACTGCAACATCTGAATTTTGG + Intergenic
1037210410 8:16379164-16379186 GGTCTTCCAAATCTGACTTGAGG + Intronic
1037603500 8:20418737-20418759 GGACTTCAATATTTGAATTTCGG - Intergenic
1037603658 8:20419883-20419905 GGGCTTCAACATAAGCATTTTGG - Intergenic
1037620372 8:20558332-20558354 GGACTTCAACATGTGAATTTTGG - Intergenic
1037803740 8:22048588-22048610 TGTCCTCAAAATCTGCTTCTCGG + Exonic
1037960152 8:23091627-23091649 GGGCTTCAAAATATGCTTTAGGG + Intronic
1038149542 8:24930184-24930206 GGGCTTCAACATATGAATTTGGG + Intergenic
1038280911 8:26163608-26163630 GGGCTTCAACATATGAATTTCGG + Intergenic
1038373744 8:27017007-27017029 GGGCTTCAACATATGAATTTGGG + Intergenic
1038689452 8:29747864-29747886 GGACTTCAACATATGAATTTTGG - Intergenic
1038752318 8:30306846-30306868 GGACTTCAGAATCTGTATTTTGG - Intergenic
1039277479 8:35949503-35949525 TGTCTTAAAAATTTGCATATTGG - Intergenic
1039384278 8:37118617-37118639 GGGCTTCAACATGTACATTTTGG - Intergenic
1039765512 8:40624111-40624133 GGGCTTCAACATATGAATTTTGG - Intronic
1040133965 8:43830843-43830865 GGGCTCCAAAATGTCCATTTTGG - Intergenic
1040425877 8:47285805-47285827 GGACTTCAACATTTGAATTTTGG + Intronic
1040724728 8:50369173-50369195 GGGCTTCAATATATGCATTTTGG - Intronic
1040869976 8:52090452-52090474 GGACTTCAACATATGAATTTTGG + Intergenic
1041415783 8:57607483-57607505 GGGCTTCAATATATGAATTTGGG - Intergenic
1041439922 8:57883337-57883359 GGACTTCAACATATGAATTTTGG - Intergenic
1041662219 8:60411553-60411575 GGACTTCAACATGTGAATTTGGG + Intergenic
1041857805 8:62478110-62478132 GGGTTTCAACATATGCATTTTGG + Intronic
1042703957 8:71647112-71647134 GGGCTTCAAAATATGAATTTTGG + Intergenic
1042874132 8:73425132-73425154 GGACTTCAACATATGAATTTGGG - Intronic
1042984980 8:74573534-74573556 GGGCTTCAAAATAAGAATTTTGG + Intergenic
1043082374 8:75783329-75783351 TGTCTACATAATATGCATTTGGG + Intergenic
1043397248 8:79851030-79851052 GGACTTCAACATATGAATTTTGG - Intergenic
1043626652 8:82269598-82269620 TGTCTTCAAAATGTGCATATAGG + Intergenic
1043848059 8:85183800-85183822 GGCCTTCAACATATGAATTTTGG - Intronic
1044199492 8:89416689-89416711 GGTTTTCAACATATGAATTTTGG - Intergenic
1044301075 8:90583759-90583781 GGACTTCAACATATGAATTTGGG + Intergenic
1044354238 8:91202385-91202407 GGACTTCAACATATGAATTTTGG + Intronic
1044462193 8:92458537-92458559 GGGCTTCGAAATATGCAATTTGG - Intergenic
1044544878 8:93448627-93448649 GGTATTCAATATATGAATTTTGG - Intergenic
1044586852 8:93876287-93876309 GGGCTTCAATATATGAATTTGGG + Intronic
1045636980 8:104202798-104202820 GGACTTCAACATATGAATTTTGG + Intronic
1045718566 8:105078207-105078229 GGGCTTCAACATATACATTTTGG + Intronic
1046304688 8:112349881-112349903 GGACTTCAAAATATAAATTTTGG - Intronic
1046673322 8:117081550-117081572 GGACTTCAACATATGAATTTTGG + Intronic
1046728487 8:117699908-117699930 GGACTTCAACATATGAATTTTGG - Intergenic
1046757270 8:117984714-117984736 GGCCTTCAGAATGTGCTTTTTGG - Intronic
1046803256 8:118451933-118451955 GGGCTTCAACATGTGAATTTTGG - Intronic
1046826525 8:118697995-118698017 GGTATGAAAAATCTGCACTTTGG + Intergenic
1046852737 8:118993816-118993838 GGACTTCAACATATGAATTTTGG + Intergenic
1047002237 8:120584666-120584688 GGACTTCAACATATGAATTTGGG - Intronic
1047603120 8:126447295-126447317 GGACTTCAATATATGAATTTGGG - Intergenic
1047834384 8:128672397-128672419 GGTCTTTAACATATGAATTTTGG - Intergenic
1047920734 8:129631992-129632014 GGGCTTCAACATTTGAATTTTGG - Intergenic
1048206579 8:132420268-132420290 GGACTTCAACATATGAATTTTGG + Intronic
1048399047 8:134046125-134046147 GGGCTTCAACGTATGCATTTTGG + Intergenic
1048502051 8:134987249-134987271 GGTATTCAAAATGTGCATGTTGG - Intergenic
1048932646 8:139327172-139327194 GGGCTTCAACATATGAATTTTGG - Intergenic
1049156687 8:141071510-141071532 GGGCTCCAACATCTGCATTTAGG + Intergenic
1050185021 9:2964233-2964255 GGACTTCAACATATGAATTTTGG - Intergenic
1050916782 9:11145893-11145915 GGGTTTCAACATATGCATTTTGG - Intergenic
1051166242 9:14265278-14265300 GGGCTTCAACATGTGAATTTTGG - Intronic
1051853144 9:21532371-21532393 GGGCTTCAAAATGTTGATTTTGG - Intergenic
1053636028 9:40005314-40005336 GGGCTTCAAAATTTAAATTTGGG - Intergenic
1053769956 9:41459333-41459355 GGGCTTCAAAATTTAAATTTGGG + Intergenic
1054246186 9:62668429-62668451 GCTTTTCAAAAGCTGGATTTTGG + Intergenic
1054316905 9:63602414-63602436 GGGCTTCAAAATTTAAATTTGGG - Intergenic
1054548631 9:66370813-66370835 GGGCTTCAAAATTTAAATTTGGG + Intergenic
1054560308 9:66702962-66702984 GCTTTTCAAAAGCTGGATTTTGG + Intergenic
1054777398 9:69135128-69135150 GGGCTTCAACATATGAATTTTGG + Intronic
1054887689 9:70216566-70216588 GGGCTTCAACATATGAATTTGGG + Intronic
1055451572 9:76435764-76435786 GGACTTCAACATATGAATTTGGG + Intronic
1055666849 9:78561434-78561456 GGACTTCAACATATGGATTTTGG + Intergenic
1056085794 9:83148286-83148308 GAACTTCAAAATATGAATTTGGG - Intergenic
1056217470 9:84418705-84418727 GGGTTTCAACATATGCATTTTGG - Intergenic
1056231387 9:84548209-84548231 GGTCTTCAAAATGTTCATCTAGG + Intergenic
1056298523 9:85218342-85218364 GGGCTTCAACATATGAATTTTGG - Intergenic
1056389630 9:86129032-86129054 GGGTTTCAACATATGCATTTTGG - Intergenic
1056432766 9:86545041-86545063 GGACTCAAAACTCTGCATTTTGG - Intergenic
1056468884 9:86886133-86886155 GGGCTTCAACATATGAATTTTGG - Intergenic
1056761095 9:89415458-89415480 GGATTTCAACATCTGAATTTGGG - Intronic
1056831461 9:89920497-89920519 GGACTTCAACATATGAATTTGGG - Intergenic
1056958713 9:91103107-91103129 GGGCTTCAACATATGAATTTTGG - Intergenic
1057018610 9:91678287-91678309 GGACTTCAACATATGAATTTTGG - Intronic
1057057436 9:91974450-91974472 GGGCTTCAACATATGAATTTTGG + Intergenic
1058056490 9:100454301-100454323 AGTCTTCAGAGTCGGCATTTTGG + Intronic
1058299154 9:103348129-103348151 GGTTTTCAACATATGAATTTTGG - Intergenic
1058570104 9:106332323-106332345 GGGCTTCAACATATGAATTTTGG + Intergenic
1058724800 9:107792269-107792291 GGACTTCAACATATGAATTTGGG - Intergenic
1058813941 9:108666823-108666845 GGACTTCAATATATGAATTTTGG - Intergenic
1059201658 9:112423287-112423309 TGTCTTCAAAACCTGGAATTTGG + Intronic
1060020807 9:120129475-120129497 GGACTTCAACATATGGATTTTGG + Intergenic
1060162348 9:121375960-121375982 GGACTTCAACATGTGAATTTTGG + Intergenic
1060291171 9:122304317-122304339 GGTGTTCAAAAACTGCATGAAGG - Intronic
1060445796 9:123686719-123686741 GTTCTTAAAAATATGCATTTAGG - Intronic
1061254527 9:129446673-129446695 GGGCTTCAACATATGAATTTGGG + Intergenic
1062141958 9:134964155-134964177 GGACTTCAACATGTGAATTTGGG + Intergenic
1185860949 X:3578939-3578961 GGATTTCAACATCTGAATTTAGG - Intergenic
1185920817 X:4090201-4090223 GGGCTTCAACATATGAATTTTGG - Intergenic
1186038641 X:5452209-5452231 GTTCTTCCACATCTGAATTTTGG - Intergenic
1186155332 X:6719391-6719413 GGGCTTCAACATATGAATTTTGG + Intergenic
1186713544 X:12226436-12226458 TAACTTCATAATCTGCATTTAGG + Intronic
1187682573 X:21782527-21782549 GGGCTTCAACATATGAATTTTGG - Intergenic
1188067051 X:25675264-25675286 GCTCTTCTAAATATCCATTTAGG - Intergenic
1188554136 X:31392532-31392554 GGTCTTCTAATTCTGCATCTGGG + Intronic
1188639997 X:32489239-32489261 GGACTTCAACATGTGAATTTTGG - Intronic
1188747451 X:33863656-33863678 GGGCTTCAAAATGTAAATTTTGG + Intergenic
1189061364 X:37756781-37756803 GGACTTCAACATATGAATTTTGG + Intronic
1189075566 X:37910439-37910461 GGACTTCAACATGTGAATTTGGG + Intronic
1189895020 X:45646262-45646284 GGGCTTCAAAATATGAGTTTTGG + Intergenic
1189919895 X:45893247-45893269 GGATTTCAACATCTGAATTTTGG - Intergenic
1189961546 X:46329306-46329328 GGGCTTCAACATATGAATTTTGG - Intergenic
1190089991 X:47429220-47429242 GGGCTTCAACATATGAATTTGGG + Intergenic
1190224396 X:48534180-48534202 GGGCTTCAACATATGAATTTGGG + Intergenic
1190872406 X:54435272-54435294 GGTTTTCAATATCTTCATTTGGG + Intergenic
1190896646 X:54625063-54625085 GGACCTCAATATATGCATTTTGG + Intergenic
1192251216 X:69415401-69415423 GGGCTTCAACATATGAATTTTGG + Intergenic
1192326246 X:70134523-70134545 TCTCTTCCAAATCTTCATTTCGG - Exonic
1193200793 X:78688008-78688030 CATCTACAAAATCTGTATTTGGG + Intergenic
1194310942 X:92305605-92305627 GGGCTTCAAAGTATGAATTTGGG + Intronic
1194461877 X:94180291-94180313 AGTTTTCAATATATGCATTTTGG - Intergenic
1194588117 X:95762815-95762837 GGGCTTCAACATATGAATTTTGG - Intergenic
1194597608 X:95878047-95878069 GGACTTCAACATATGAATTTAGG + Intergenic
1194665028 X:96667943-96667965 GGACTTCAACATATCCATTTTGG + Intergenic
1194721694 X:97347683-97347705 GGACTTCAACATATGAATTTTGG - Intronic
1194739283 X:97553065-97553087 GGACTTCAACATATGTATTTGGG + Intronic
1194795134 X:98201714-98201736 GGGCTTCAACATATGAATTTTGG + Intergenic
1194795423 X:98205853-98205875 GGGCTTCAACATATGAATTTTGG + Intergenic
1195508887 X:105691113-105691135 GGGCTTCAACATATGAATTTTGG + Intronic
1195663396 X:107404898-107404920 GGGCTTCAATATATGCATTTAGG + Intergenic
1196187686 X:112762136-112762158 GGGCTTCAATATATGGATTTGGG + Intergenic
1196242914 X:113365130-113365152 GGTATTCAAAGTTTGAATTTGGG + Intergenic
1196577350 X:117334934-117334956 GGACTTCAACATATGAATTTGGG + Intergenic
1196896330 X:120340402-120340424 GGGCTTCAACATATGAATTTTGG + Intergenic
1196910296 X:120478037-120478059 GGACTTCAACATATGAATTTTGG - Intergenic
1197032814 X:121838416-121838438 GGTATTCAAAATCACCATGTTGG - Intergenic
1197328886 X:125128900-125128922 GGGCTTCAACATATGAATTTGGG - Intergenic
1197505042 X:127291360-127291382 GGACTTCAACATGTGTATTTTGG - Intergenic
1197823260 X:130563057-130563079 GGGCTTCAACATATGAATTTGGG + Intergenic
1197823423 X:130564213-130564235 GGTCTTCAACATATGAATTTTGG + Intergenic
1197919585 X:131578048-131578070 AGACTGCAAAATCTGCTTTTTGG - Intergenic
1198018719 X:132637221-132637243 GGGCTTGCCAATCTGCATTTTGG + Intronic
1198173758 X:134134220-134134242 GGACTTCAACATATGCATGTTGG - Intergenic
1198656304 X:138917205-138917227 GGGCTTCAACATATGAATTTGGG - Intronic
1198850699 X:140962843-140962865 GGTTTTCAACATATGAATTTTGG + Intergenic
1198922907 X:141750410-141750432 GGGCTTCAACATATGCATTTTGG + Intergenic
1199249717 X:145646568-145646590 GGACTTCAACATGTGCAATTTGG + Intergenic
1199321387 X:146443336-146443358 AGTCTCCAAAAACTGCATTCAGG + Intergenic
1200304859 X:155014007-155014029 GGACTTCAACATATGAATTTGGG + Intronic
1200619217 Y:5419880-5419902 GGGCTTCAAAGTATGAATTTGGG + Intronic
1201223833 Y:11797246-11797268 GGACTTCTACATGTGCATTTTGG + Intergenic
1201776854 Y:17675129-17675151 GGTCTTCCAAATGTCCCTTTGGG + Intergenic
1201824702 Y:18230863-18230885 GGTCTTCCAAATGTCCCTTTGGG - Intergenic
1202240385 Y:22760978-22761000 GGTCTTCAATCCCAGCATTTTGG - Intergenic
1202393371 Y:24394732-24394754 GGTCTTCAATCCCAGCATTTTGG - Intergenic
1202477414 Y:25275368-25275390 GGTCTTCAATCCCAGCATTTTGG + Intergenic