ID: 935911767

View in Genome Browser
Species Human (GRCh38)
Location 2:107904397-107904419
Sequence CATATTAGGACCCACCTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935911767_935911773 11 Left 935911767 2:107904397-107904419 CCATTTAGGTGGGTCCTAATATG No data
Right 935911773 2:107904431-107904453 CTCACTGCTATTAAATGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935911767 Original CRISPR CATATTAGGACCCACCTAAA TGG (reversed) Intergenic
No off target data available for this crispr