ID: 935912398

View in Genome Browser
Species Human (GRCh38)
Location 2:107911210-107911232
Sequence ATCCACATGTTGCACATAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935912397_935912398 -9 Left 935912397 2:107911196-107911218 CCAGCACTCACTGAATCCACATG No data
Right 935912398 2:107911210-107911232 ATCCACATGTTGCACATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935912398 Original CRISPR ATCCACATGTTGCACATAAT AGG Intergenic
No off target data available for this crispr