ID: 935914147

View in Genome Browser
Species Human (GRCh38)
Location 2:107931147-107931169
Sequence ATAAGCAATGGGCCTTGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935914147_935914153 14 Left 935914147 2:107931147-107931169 CCCTAGCAAGGCCCATTGCTTAT No data
Right 935914153 2:107931184-107931206 ACGTACATATTTAATGAAAGAGG No data
935914147_935914151 -10 Left 935914147 2:107931147-107931169 CCCTAGCAAGGCCCATTGCTTAT No data
Right 935914151 2:107931160-107931182 CATTGCTTATCCATATTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935914147 Original CRISPR ATAAGCAATGGGCCTTGCTA GGG (reversed) Intergenic
No off target data available for this crispr