ID: 935915629

View in Genome Browser
Species Human (GRCh38)
Location 2:107946734-107946756
Sequence TAACTTCTGAACCTATTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935915629_935915633 11 Left 935915629 2:107946734-107946756 CCCATAAATAGGTTCAGAAGTTA No data
Right 935915633 2:107946768-107946790 ATAGTCCCAGGTTGTCCATCAGG 0: 65
1: 77
2: 26
3: 15
4: 91
935915629_935915632 -1 Left 935915629 2:107946734-107946756 CCCATAAATAGGTTCAGAAGTTA No data
Right 935915632 2:107946756-107946778 ATAATTGGTTGAATAGTCCCAGG 0: 64
1: 63
2: 19
3: 27
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935915629 Original CRISPR TAACTTCTGAACCTATTTAT GGG (reversed) Intergenic
No off target data available for this crispr