ID: 935921465

View in Genome Browser
Species Human (GRCh38)
Location 2:108020345-108020367
Sequence ACACATGGTGGGCACTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935921465_935921476 28 Left 935921465 2:108020345-108020367 CCAATAAAGTGCCCACCATGTGT No data
Right 935921476 2:108020396-108020418 TTTAATACGTGGAGGGTAAGGGG No data
935921465_935921471 17 Left 935921465 2:108020345-108020367 CCAATAAAGTGCCCACCATGTGT No data
Right 935921471 2:108020385-108020407 AAAACTACATATTTAATACGTGG No data
935921465_935921473 21 Left 935921465 2:108020345-108020367 CCAATAAAGTGCCCACCATGTGT No data
Right 935921473 2:108020389-108020411 CTACATATTTAATACGTGGAGGG No data
935921465_935921472 20 Left 935921465 2:108020345-108020367 CCAATAAAGTGCCCACCATGTGT No data
Right 935921472 2:108020388-108020410 ACTACATATTTAATACGTGGAGG No data
935921465_935921474 26 Left 935921465 2:108020345-108020367 CCAATAAAGTGCCCACCATGTGT No data
Right 935921474 2:108020394-108020416 TATTTAATACGTGGAGGGTAAGG No data
935921465_935921475 27 Left 935921465 2:108020345-108020367 CCAATAAAGTGCCCACCATGTGT No data
Right 935921475 2:108020395-108020417 ATTTAATACGTGGAGGGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935921465 Original CRISPR ACACATGGTGGGCACTTTAT TGG (reversed) Intergenic
No off target data available for this crispr