ID: 935921470

View in Genome Browser
Species Human (GRCh38)
Location 2:108020360-108020382
Sequence TAAACTATTCCCTCTACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935921470_935921474 11 Left 935921470 2:108020360-108020382 CCATGTGTAGAGGGAATAGTTTA No data
Right 935921474 2:108020394-108020416 TATTTAATACGTGGAGGGTAAGG No data
935921470_935921471 2 Left 935921470 2:108020360-108020382 CCATGTGTAGAGGGAATAGTTTA No data
Right 935921471 2:108020385-108020407 AAAACTACATATTTAATACGTGG No data
935921470_935921472 5 Left 935921470 2:108020360-108020382 CCATGTGTAGAGGGAATAGTTTA No data
Right 935921472 2:108020388-108020410 ACTACATATTTAATACGTGGAGG No data
935921470_935921475 12 Left 935921470 2:108020360-108020382 CCATGTGTAGAGGGAATAGTTTA No data
Right 935921475 2:108020395-108020417 ATTTAATACGTGGAGGGTAAGGG No data
935921470_935921477 26 Left 935921470 2:108020360-108020382 CCATGTGTAGAGGGAATAGTTTA No data
Right 935921477 2:108020409-108020431 GGGTAAGGGGTTCTAAATAGAGG No data
935921470_935921473 6 Left 935921470 2:108020360-108020382 CCATGTGTAGAGGGAATAGTTTA No data
Right 935921473 2:108020389-108020411 CTACATATTTAATACGTGGAGGG No data
935921470_935921476 13 Left 935921470 2:108020360-108020382 CCATGTGTAGAGGGAATAGTTTA No data
Right 935921476 2:108020396-108020418 TTTAATACGTGGAGGGTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935921470 Original CRISPR TAAACTATTCCCTCTACACA TGG (reversed) Intergenic
No off target data available for this crispr