ID: 935921471

View in Genome Browser
Species Human (GRCh38)
Location 2:108020385-108020407
Sequence AAAACTACATATTTAATACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935921465_935921471 17 Left 935921465 2:108020345-108020367 CCAATAAAGTGCCCACCATGTGT No data
Right 935921471 2:108020385-108020407 AAAACTACATATTTAATACGTGG No data
935921470_935921471 2 Left 935921470 2:108020360-108020382 CCATGTGTAGAGGGAATAGTTTA No data
Right 935921471 2:108020385-108020407 AAAACTACATATTTAATACGTGG No data
935921469_935921471 5 Left 935921469 2:108020357-108020379 CCACCATGTGTAGAGGGAATAGT No data
Right 935921471 2:108020385-108020407 AAAACTACATATTTAATACGTGG No data
935921468_935921471 6 Left 935921468 2:108020356-108020378 CCCACCATGTGTAGAGGGAATAG No data
Right 935921471 2:108020385-108020407 AAAACTACATATTTAATACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935921471 Original CRISPR AAAACTACATATTTAATACG TGG Intergenic
No off target data available for this crispr