ID: 935921472

View in Genome Browser
Species Human (GRCh38)
Location 2:108020388-108020410
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935921465_935921472 20 Left 935921465 2:108020345-108020367 CCAATAAAGTGCCCACCATGTGT No data
Right 935921472 2:108020388-108020410 ACTACATATTTAATACGTGGAGG No data
935921468_935921472 9 Left 935921468 2:108020356-108020378 CCCACCATGTGTAGAGGGAATAG No data
Right 935921472 2:108020388-108020410 ACTACATATTTAATACGTGGAGG No data
935921469_935921472 8 Left 935921469 2:108020357-108020379 CCACCATGTGTAGAGGGAATAGT No data
Right 935921472 2:108020388-108020410 ACTACATATTTAATACGTGGAGG No data
935921470_935921472 5 Left 935921470 2:108020360-108020382 CCATGTGTAGAGGGAATAGTTTA No data
Right 935921472 2:108020388-108020410 ACTACATATTTAATACGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr