ID: 935921477

View in Genome Browser
Species Human (GRCh38)
Location 2:108020409-108020431
Sequence GGGTAAGGGGTTCTAAATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935921469_935921477 29 Left 935921469 2:108020357-108020379 CCACCATGTGTAGAGGGAATAGT No data
Right 935921477 2:108020409-108020431 GGGTAAGGGGTTCTAAATAGAGG No data
935921468_935921477 30 Left 935921468 2:108020356-108020378 CCCACCATGTGTAGAGGGAATAG No data
Right 935921477 2:108020409-108020431 GGGTAAGGGGTTCTAAATAGAGG No data
935921470_935921477 26 Left 935921470 2:108020360-108020382 CCATGTGTAGAGGGAATAGTTTA No data
Right 935921477 2:108020409-108020431 GGGTAAGGGGTTCTAAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935921477 Original CRISPR GGGTAAGGGGTTCTAAATAG AGG Intergenic
No off target data available for this crispr