ID: 935924393

View in Genome Browser
Species Human (GRCh38)
Location 2:108051771-108051793
Sequence CCTTGTCATTTCCATCATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935924390_935924393 -10 Left 935924390 2:108051758-108051780 CCTCAGCCTATGGCCTTGTCATT No data
Right 935924393 2:108051771-108051793 CCTTGTCATTTCCATCATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935924393 Original CRISPR CCTTGTCATTTCCATCATTA TGG Intergenic
No off target data available for this crispr