ID: 935926071

View in Genome Browser
Species Human (GRCh38)
Location 2:108070288-108070310
Sequence AGGGAGCAGCAGAAAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935926071_935926076 3 Left 935926071 2:108070288-108070310 CCTGTCCCTTTCTGCTGCTCCCT No data
Right 935926076 2:108070314-108070336 ACTCTCTTGCATAAATACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935926071 Original CRISPR AGGGAGCAGCAGAAAGGGAC AGG (reversed) Intergenic
No off target data available for this crispr