ID: 935926349

View in Genome Browser
Species Human (GRCh38)
Location 2:108073959-108073981
Sequence GTATAGCCAAGGCACTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935926349_935926352 11 Left 935926349 2:108073959-108073981 CCACAATAGTGCCTTGGCTATAC No data
Right 935926352 2:108073993-108074015 GAATTCCCATAATTTTTGCTTGG No data
935926349_935926355 18 Left 935926349 2:108073959-108073981 CCACAATAGTGCCTTGGCTATAC No data
Right 935926355 2:108074000-108074022 CATAATTTTTGCTTGGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935926349 Original CRISPR GTATAGCCAAGGCACTATTG TGG (reversed) Intergenic
No off target data available for this crispr