ID: 935927795

View in Genome Browser
Species Human (GRCh38)
Location 2:108089213-108089235
Sequence CCTCATGGATAGCCTCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935927786_935927795 8 Left 935927786 2:108089182-108089204 CCTAGGTAAAAGTTTGCTGTAGG No data
Right 935927795 2:108089213-108089235 CCTCATGGATAGCCTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935927795 Original CRISPR CCTCATGGATAGCCTCTGCT AGG Intergenic
No off target data available for this crispr