ID: 935929519

View in Genome Browser
Species Human (GRCh38)
Location 2:108108744-108108766
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935929517_935929519 1 Left 935929517 2:108108720-108108742 CCTTTTTCTTCCTTCAACTTCAT No data
Right 935929519 2:108108744-108108766 GTGACATTTGAACATGTTGAAGG No data
935929518_935929519 -9 Left 935929518 2:108108730-108108752 CCTTCAACTTCATTGTGACATTT No data
Right 935929519 2:108108744-108108766 GTGACATTTGAACATGTTGAAGG No data
935929516_935929519 22 Left 935929516 2:108108699-108108721 CCAGAGCAGTACTAGTCTGGTCC No data
Right 935929519 2:108108744-108108766 GTGACATTTGAACATGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr