ID: 935929854

View in Genome Browser
Species Human (GRCh38)
Location 2:108112838-108112860
Sequence CCTCAAAGATTGAAGGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935929854_935929860 7 Left 935929854 2:108112838-108112860 CCATCTACCTTCAATCTTTGAGG No data
Right 935929860 2:108112868-108112890 CCTTTGAATGAAGTTTTTGTGGG 0: 2
1: 6
2: 69
3: 198
4: 491
935929854_935929858 6 Left 935929854 2:108112838-108112860 CCATCTACCTTCAATCTTTGAGG No data
Right 935929858 2:108112867-108112889 GCCTTTGAATGAAGTTTTTGTGG No data
935929854_935929861 8 Left 935929854 2:108112838-108112860 CCATCTACCTTCAATCTTTGAGG No data
Right 935929861 2:108112869-108112891 CTTTGAATGAAGTTTTTGTGGGG 0: 2
1: 10
2: 114
3: 355
4: 1020

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935929854 Original CRISPR CCTCAAAGATTGAAGGTAGA TGG (reversed) Intergenic
No off target data available for this crispr