ID: 935930405

View in Genome Browser
Species Human (GRCh38)
Location 2:108118002-108118024
Sequence AAGATCAGCCCCAAATGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935930405_935930412 4 Left 935930405 2:108118002-108118024 CCTGGCCATTTGGGGCTGATCTT No data
Right 935930412 2:108118029-108118051 GGGGTTAGGAATTGGTTTCCCGG No data
935930405_935930413 19 Left 935930405 2:108118002-108118024 CCTGGCCATTTGGGGCTGATCTT No data
Right 935930413 2:108118044-108118066 TTTCCCGGATTATTTACCAGAGG No data
935930405_935930410 -10 Left 935930405 2:108118002-108118024 CCTGGCCATTTGGGGCTGATCTT No data
Right 935930410 2:108118015-108118037 GGCTGATCTTTATTGGGGTTAGG No data
935930405_935930411 -4 Left 935930405 2:108118002-108118024 CCTGGCCATTTGGGGCTGATCTT No data
Right 935930411 2:108118021-108118043 TCTTTATTGGGGTTAGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935930405 Original CRISPR AAGATCAGCCCCAAATGGCC AGG (reversed) Intergenic
No off target data available for this crispr