ID: 935930432

View in Genome Browser
Species Human (GRCh38)
Location 2:108118201-108118223
Sequence CTGAATATACATATGAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935930432_935930436 27 Left 935930432 2:108118201-108118223 CCCTTGTTCATATGTATATTCAG No data
Right 935930436 2:108118251-108118273 TTGAATTGTGCACTTTTAATGGG No data
935930432_935930435 26 Left 935930432 2:108118201-108118223 CCCTTGTTCATATGTATATTCAG No data
Right 935930435 2:108118250-108118272 ATTGAATTGTGCACTTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935930432 Original CRISPR CTGAATATACATATGAACAA GGG (reversed) Intergenic
No off target data available for this crispr