ID: 935933444

View in Genome Browser
Species Human (GRCh38)
Location 2:108154854-108154876
Sequence TAGCGCTGATGAGCCCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935933444_935933452 25 Left 935933444 2:108154854-108154876 CCACCCTGGGCTCATCAGCGCTA No data
Right 935933452 2:108154902-108154924 CAGGAGTAGGATAAAGAACCAGG No data
935933444_935933448 12 Left 935933444 2:108154854-108154876 CCACCCTGGGCTCATCAGCGCTA No data
Right 935933448 2:108154889-108154911 CAAAAAGCCCAGCCAGGAGTAGG No data
935933444_935933447 6 Left 935933444 2:108154854-108154876 CCACCCTGGGCTCATCAGCGCTA No data
Right 935933447 2:108154883-108154905 GATCAGCAAAAAGCCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935933444 Original CRISPR TAGCGCTGATGAGCCCAGGG TGG (reversed) Intergenic
No off target data available for this crispr