ID: 935934918

View in Genome Browser
Species Human (GRCh38)
Location 2:108171228-108171250
Sequence TTGAATGTGCTTGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935934918_935934921 16 Left 935934918 2:108171228-108171250 CCTTCCTCCTCAAGCACATTCAA No data
Right 935934921 2:108171267-108171289 GAAGACTCTACATCACTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935934918 Original CRISPR TTGAATGTGCTTGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr