ID: 935935537

View in Genome Browser
Species Human (GRCh38)
Location 2:108178530-108178552
Sequence ATGAACAACCTGCCATCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935935535_935935537 7 Left 935935535 2:108178500-108178522 CCATTATAAATCCAAGCAGAGAT No data
Right 935935537 2:108178530-108178552 ATGAACAACCTGCCATCACACGG No data
935935536_935935537 -4 Left 935935536 2:108178511-108178533 CCAAGCAGAGATTGATTTGATGA No data
Right 935935537 2:108178530-108178552 ATGAACAACCTGCCATCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935935537 Original CRISPR ATGAACAACCTGCCATCACA CGG Intergenic
No off target data available for this crispr