ID: 935935749

View in Genome Browser
Species Human (GRCh38)
Location 2:108181408-108181430
Sequence ATGAGATGGGAGAAGTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935935741_935935749 25 Left 935935741 2:108181360-108181382 CCTAACTTAGGGTGAATATTTGG No data
Right 935935749 2:108181408-108181430 ATGAGATGGGAGAAGTGTGAGGG No data
935935744_935935749 0 Left 935935744 2:108181385-108181407 CCAACAACTGATCAGGTGAAAGG No data
Right 935935749 2:108181408-108181430 ATGAGATGGGAGAAGTGTGAGGG No data
935935740_935935749 26 Left 935935740 2:108181359-108181381 CCCTAACTTAGGGTGAATATTTG No data
Right 935935749 2:108181408-108181430 ATGAGATGGGAGAAGTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935935749 Original CRISPR ATGAGATGGGAGAAGTGTGA GGG Intergenic
No off target data available for this crispr