ID: 935939880

View in Genome Browser
Species Human (GRCh38)
Location 2:108227123-108227145
Sequence CAGCCAAGAGTTGAACCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935939880_935939881 21 Left 935939880 2:108227123-108227145 CCTTGGGGTTCAACTCTTGGCTG No data
Right 935939881 2:108227167-108227189 ATATTTATGTTTTTCACTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935939880 Original CRISPR CAGCCAAGAGTTGAACCCCA AGG (reversed) Intergenic