ID: 935940109

View in Genome Browser
Species Human (GRCh38)
Location 2:108229157-108229179
Sequence GGTTCTAAGCAGAAGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935940105_935940109 17 Left 935940105 2:108229117-108229139 CCCAGGAGGCTGATGGGGAGTTG No data
Right 935940109 2:108229157-108229179 GGTTCTAAGCAGAAGCTGCAAGG No data
935940106_935940109 16 Left 935940106 2:108229118-108229140 CCAGGAGGCTGATGGGGAGTTGA No data
Right 935940109 2:108229157-108229179 GGTTCTAAGCAGAAGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935940109 Original CRISPR GGTTCTAAGCAGAAGCTGCA AGG Intergenic
No off target data available for this crispr