ID: 935944149

View in Genome Browser
Species Human (GRCh38)
Location 2:108270663-108270685
Sequence CCATCAGTTTGGAGCTTAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935944149_935944156 12 Left 935944149 2:108270663-108270685 CCGCCTAAGCTCCAAACTGATGG No data
Right 935944156 2:108270698-108270720 ACCACCACCAGTACCCACCATGG No data
935944149_935944161 21 Left 935944149 2:108270663-108270685 CCGCCTAAGCTCCAAACTGATGG No data
Right 935944161 2:108270707-108270729 AGTACCCACCATGGAAATTAGGG No data
935944149_935944160 20 Left 935944149 2:108270663-108270685 CCGCCTAAGCTCCAAACTGATGG No data
Right 935944160 2:108270706-108270728 CAGTACCCACCATGGAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935944149 Original CRISPR CCATCAGTTTGGAGCTTAGG CGG (reversed) Intergenic
No off target data available for this crispr