ID: 935944629

View in Genome Browser
Species Human (GRCh38)
Location 2:108274356-108274378
Sequence GACAGCTCTTGGCCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935944629_935944632 4 Left 935944629 2:108274356-108274378 CCAGTAGCAGGCCAAGAGCTGTC No data
Right 935944632 2:108274383-108274405 AAAAGGAAAGTAGTTATCTGTGG No data
935944629_935944633 17 Left 935944629 2:108274356-108274378 CCAGTAGCAGGCCAAGAGCTGTC No data
Right 935944633 2:108274396-108274418 TTATCTGTGGAAGATAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935944629 Original CRISPR GACAGCTCTTGGCCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr