ID: 935947608

View in Genome Browser
Species Human (GRCh38)
Location 2:108300481-108300503
Sequence GACCCCCATGTGCCTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 193}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935947608_935947616 26 Left 935947608 2:108300481-108300503 CCTGCTGCAGGCACATGGGGGTC 0: 1
1: 0
2: 1
3: 19
4: 193
Right 935947616 2:108300530-108300552 AGTCCTCTCTTCTCTGGTCCTGG 0: 1
1: 1
2: 2
3: 17
4: 236
935947608_935947611 -7 Left 935947608 2:108300481-108300503 CCTGCTGCAGGCACATGGGGGTC 0: 1
1: 0
2: 1
3: 19
4: 193
Right 935947611 2:108300497-108300519 GGGGGTCATCTCTGGCTGGCAGG 0: 1
1: 0
2: 3
3: 99
4: 691
935947608_935947612 -3 Left 935947608 2:108300481-108300503 CCTGCTGCAGGCACATGGGGGTC 0: 1
1: 0
2: 1
3: 19
4: 193
Right 935947612 2:108300501-108300523 GTCATCTCTGGCTGGCAGGAAGG 0: 1
1: 0
2: 1
3: 39
4: 280
935947608_935947613 2 Left 935947608 2:108300481-108300503 CCTGCTGCAGGCACATGGGGGTC 0: 1
1: 0
2: 1
3: 19
4: 193
Right 935947613 2:108300506-108300528 CTCTGGCTGGCAGGAAGGTGAGG 0: 1
1: 0
2: 7
3: 63
4: 644
935947608_935947615 20 Left 935947608 2:108300481-108300503 CCTGCTGCAGGCACATGGGGGTC 0: 1
1: 0
2: 1
3: 19
4: 193
Right 935947615 2:108300524-108300546 TGAGGGAGTCCTCTCTTCTCTGG 0: 1
1: 0
2: 2
3: 20
4: 240
935947608_935947614 3 Left 935947608 2:108300481-108300503 CCTGCTGCAGGCACATGGGGGTC 0: 1
1: 0
2: 1
3: 19
4: 193
Right 935947614 2:108300507-108300529 TCTGGCTGGCAGGAAGGTGAGGG 0: 1
1: 0
2: 7
3: 56
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935947608 Original CRISPR GACCCCCATGTGCCTGCAGC AGG (reversed) Intronic
900112766 1:1015510-1015532 GACCCCCATCTGGCTGCACCAGG + Intergenic
900173398 1:1281441-1281463 GACCCCCACATGCCGGGAGCTGG + Exonic
901702807 1:11054466-11054488 GACCCCCAAGTGTCTGCTGCAGG - Intergenic
902333484 1:15742360-15742382 GCACCCCGTGTGCCTGGAGCTGG + Intergenic
902470614 1:16645697-16645719 GATCCCCATCTGCCTTCAGGAGG + Intergenic
902488190 1:16761763-16761785 GATCCCCATCTGCCTTCAGGAGG - Intronic
905311153 1:37050052-37050074 AATCTCCATGTGCCTGTAGCCGG + Intergenic
905941552 1:41867251-41867273 GGCCATCATGTGCCTACAGCAGG + Intronic
906117853 1:43367698-43367720 GGCCCCCATTTGCCTACACCCGG - Exonic
906742932 1:48199946-48199968 GCCCCACACGTGCCTGCAACAGG + Intergenic
908433562 1:64082566-64082588 GATCCCCAAGGGGCTGCAGCTGG - Intronic
912869494 1:113291097-113291119 TACCCCCCTGTGCATGCAGCTGG + Intergenic
915441499 1:155948092-155948114 GAGCCCCCTGAGCCTGCAGATGG - Intronic
915745025 1:158149375-158149397 GACCCCCATGGGACAGCAGCTGG - Intergenic
916682310 1:167115826-167115848 GACCCCCACATCCCTGCATCAGG - Intronic
919764112 1:201115298-201115320 GACGCCCAGCTGCATGCAGCTGG + Exonic
919764118 1:201115303-201115325 GCCCCCCAGCTGCATGCAGCTGG - Exonic
919771656 1:201164628-201164650 GATCCCATTGTGCCTGAAGCTGG - Intronic
919907115 1:202085672-202085694 GAGGCCCCTGTGCCAGCAGCGGG - Intergenic
920311820 1:205053029-205053051 GACCCAGATGTGCCTGGAGCTGG + Intronic
922223426 1:223626174-223626196 GACCCCCAGCTGCCTGAAGAAGG + Intronic
922717837 1:227886402-227886424 GACCCCCATGGGGCTCCAGGTGG + Intergenic
922898257 1:229117149-229117171 GACCTGTATGTGCCCGCAGCTGG + Intergenic
923892954 1:238235867-238235889 GACTCCCATGTGACAACAGCAGG + Intergenic
1064585362 10:16834349-16834371 AGCCCCCTTGTGCCTGGAGCAGG - Intronic
1065678295 10:28202218-28202240 TATCCACATGTGGCTGCAGCTGG + Exonic
1069838842 10:71326725-71326747 GAATGCCAAGTGCCTGCAGCTGG - Intronic
1069980344 10:72248089-72248111 GACCCACCTTTGCCTGCAGCTGG + Intergenic
1070752483 10:78972476-78972498 GACCCCCCTGAGGCTGAAGCAGG - Intergenic
1076148468 10:128143885-128143907 GAACCCCCTGTGGCTGGAGCAGG - Intergenic
1076268469 10:129129826-129129848 GACCCCCCTGTGACTCCATCTGG + Intergenic
1077012651 11:385751-385773 GACCCGGCTGTGCCTTCAGCTGG - Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077342843 11:2033634-2033656 GCCCCCCATGGGCCTGGAGCAGG - Intergenic
1078078239 11:8180910-8180932 GAGCCCAATGTGGCTGGAGCTGG - Intergenic
1078531012 11:12136865-12136887 GAGCCCCGTGTCCCTGCTGCTGG + Intronic
1078852787 11:15179572-15179594 GGCCCCCATGTCAGTGCAGCAGG + Intronic
1082215379 11:49561442-49561464 GTCCCCCCTCTTCCTGCAGCAGG - Intergenic
1083624844 11:64067171-64067193 GAGCCGCATGTGCCTACAGGTGG - Intronic
1084439874 11:69166755-69166777 AAGCCCGATGTGCCTGCAGGGGG + Intergenic
1086634194 11:89063036-89063058 GTCCCCCCTCTTCCTGCAGCAGG + Intronic
1089005137 11:115084627-115084649 GAGCCCCCAGTGACTGCAGCAGG + Intergenic
1090898936 11:131008110-131008132 GACCCTCATGTTCCTGCATAGGG + Intergenic
1202825829 11_KI270721v1_random:88823-88845 GCCCCCCATGGGCCTGGAGCAGG - Intergenic
1091690990 12:2597320-2597342 GTCCCCCTTGTGCCAGCACCAGG + Intronic
1092987607 12:13861630-13861652 GGACCCCGTGTGGCTGCAGCAGG + Intronic
1096116986 12:49060491-49060513 GACCCCCCGGTGCCGGGAGCCGG - Intergenic
1096184676 12:49570864-49570886 GACCCCGGTGTGGCTGGAGCAGG + Intronic
1096518886 12:52173160-52173182 GACCTCCATGTACCTCCAGCTGG - Exonic
1097515554 12:60601170-60601192 GCCTCCCATGTGCCTGGAGAAGG - Intergenic
1097593457 12:61599829-61599851 GACACACATGTGGCAGCAGCAGG - Intergenic
1100610251 12:96185989-96186011 GAACCCATTGTGCCTGCAGTTGG - Intergenic
1100775187 12:97965843-97965865 GACCCCCATGAACCCACAGCTGG - Intergenic
1100831031 12:98516431-98516453 GACCACCAGCCGCCTGCAGCGGG + Intronic
1101839957 12:108320969-108320991 GTCCCCCATCTGCCAGCTGCAGG + Intronic
1104043273 12:125144363-125144385 GAACCCCCTGTGATTGCAGCAGG + Intergenic
1104144177 12:126017127-126017149 GTGCCCCATGTGGCTGCATCTGG - Intergenic
1104942203 12:132400420-132400442 GACCCATATGTGCCGGGAGCGGG - Intergenic
1105428748 13:20318069-20318091 GTGCCCCATCTGCCAGCAGCAGG + Intergenic
1106570447 13:30922676-30922698 GACACCCGTGTGGCTGCAGGTGG + Intronic
1113910491 13:113839065-113839087 GATGCCCATGTGCTTGCAGGAGG + Intronic
1117752064 14:58934773-58934795 AACCCCCATGTTCCTGCAAAAGG + Intergenic
1119654640 14:76408436-76408458 CACCCCCATGCACCTGCACCTGG - Intronic
1202872605 14_GL000225v1_random:177808-177830 GACCCCCAGGTGGCTACAACAGG - Intergenic
1123435107 15:20248634-20248656 GACCCACATGTGGATGCAGAGGG + Intergenic
1124484166 15:30100984-30101006 GGCCCCCATGTGCGTGCTGATGG + Intergenic
1124490557 15:30152336-30152358 GGCCCCCATGTGCGTGCTGATGG + Intergenic
1124519416 15:30396240-30396262 GGCCCCCATGTGCGTGCTGATGG - Intergenic
1124539239 15:30569981-30570003 GGCCCCCATGTGCGTGCTGATGG + Intergenic
1124752976 15:32385993-32386015 GGCCCCCATGTGCGTGCTGATGG - Intergenic
1124759411 15:32437591-32437613 GGCCCCCATGTGCGTGCTGATGG - Intergenic
1124974719 15:34521693-34521715 GGCCCCCATGTGCGTGCTGATGG - Intergenic
1125506728 15:40271663-40271685 GCCCTGCCTGTGCCTGCAGCAGG - Intronic
1126158534 15:45587430-45587452 GACACTCATGTCCCTCCAGCTGG - Exonic
1127496895 15:59521366-59521388 GACCCCCATGTGAAGGGAGCTGG + Exonic
1128370168 15:67034540-67034562 GGCCCCCATTGTCCTGCAGCTGG + Intergenic
1129878677 15:78993471-78993493 AACACCCATGTTCCTGCACCTGG - Intronic
1131836902 15:96399942-96399964 GACCCCCATGTTCCTCTAGACGG + Intergenic
1132204075 15:99974614-99974636 GCCCTCCCTGTGCCTGCATCAGG - Intronic
1132457545 16:32513-32535 GGCCCCCATTGGCCTCCAGCAGG + Intergenic
1134128170 16:11630483-11630505 GACTCCTGTGTGCCTGGAGCAGG - Intronic
1134295862 16:12945170-12945192 GAGCCCCAGGTGTTTGCAGCTGG + Intronic
1137396214 16:48117643-48117665 GACTCCCATGAGCGTCCAGCAGG - Intronic
1138553342 16:57758854-57758876 GACCCCGCTGGGCCTGAAGCTGG - Exonic
1141796288 16:86277505-86277527 GAATGCCATGCGCCTGCAGCTGG - Intergenic
1145212006 17:21020840-21020862 GTCCCCCATGGGCCTGCAGCTGG - Intronic
1147393189 17:40122387-40122409 GGCCCCCATGGGCCGGCGGCGGG + Intronic
1151937846 17:77274245-77274267 GAGCCCGATGAGCCTTCAGCTGG + Intergenic
1151954949 17:77375528-77375550 TGCCCCCATGTGCCTCCATCTGG + Intronic
1152307780 17:79531240-79531262 GACCCTCCTGGGCCGGCAGCAGG - Intergenic
1152517608 17:80835033-80835055 GAATACCATTTGCCTGCAGCTGG + Intronic
1152863756 17:82710337-82710359 CTCCCCCATGTGCCTGCTGTGGG + Intergenic
1153174828 18:2359215-2359237 CACCCTCATGTGCCTGGACCTGG + Intergenic
1155514499 18:26610770-26610792 GACCCACAGGTGCATGCAGCTGG - Intronic
1158419444 18:57279855-57279877 GAGGCCCCTGTGGCTGCAGCTGG - Intergenic
1161011301 19:1960513-1960535 GTCCCCCGTGTGCCTGCGCCTGG + Intronic
1161345749 19:3768073-3768095 GACCACGCTGTGACTGCAGCAGG - Intronic
1161427288 19:4210486-4210508 GAGGCCCAGGTGGCTGCAGCAGG - Intronic
1161479544 19:4503662-4503684 GAGCCCCAGGTGCCTGGGGCAGG + Exonic
1163770288 19:19186922-19186944 GACGCACATGCTCCTGCAGCCGG + Exonic
1163862068 19:19747834-19747856 GACCCGCCTGTGCCTCCTGCTGG - Intergenic
1164892600 19:31837626-31837648 GACCTCCATGTGCCTTCCCCAGG + Intergenic
1165432849 19:35782274-35782296 TACCCCCAAGTGCCCGCAGGTGG - Intronic
1166209378 19:41296393-41296415 GACCCACATGTCCCTTAAGCAGG - Intronic
1166355572 19:42225357-42225379 CCCGCCCATGAGCCTGCAGCCGG - Exonic
1166992163 19:46699101-46699123 GAGACCCATGTAGCTGCAGCAGG - Intronic
1167491605 19:49795774-49795796 GGCCCCCAGATGCCAGCAGCAGG - Intronic
1168037540 19:53731969-53731991 GACCCCAATGTCCTTGCAGGTGG + Intergenic
1168269385 19:55241388-55241410 GGCCTCCCTGTGTCTGCAGCTGG - Exonic
1168304707 19:55429258-55429280 GACCCCCAAATCCCGGCAGCTGG + Exonic
1202703007 1_KI270713v1_random:2477-2499 GATCCCCATCTGCCTTCAGGAGG + Intergenic
932779291 2:74549818-74549840 GCCCTCCCTGTGCCTGGAGCAGG + Intronic
933093199 2:78146345-78146367 GACACCCCTGAGCCTGCAGGGGG - Intergenic
933157036 2:78987965-78987987 GACCCCCTGGTGCCTACAGGAGG + Intergenic
934083784 2:88492235-88492257 AACCCCCATGGGCCAGAAGCTGG - Intergenic
935947608 2:108300481-108300503 GACCCCCATGTGCCTGCAGCAGG - Intronic
937094537 2:119226790-119226812 GCCTCCCATGTGCCAGCATCCGG + Intronic
937097781 2:119247093-119247115 GACTGCAATGTGCCTGCAGGGGG + Intronic
944535560 2:200705971-200705993 TAACCCCAGGTGCTTGCAGCTGG - Intergenic
947140984 2:227019108-227019130 GCCCCCCAGGTGACTGTAGCAGG - Intronic
947462300 2:230313996-230314018 GACCCTCATACACCTGCAGCTGG + Intergenic
948016028 2:234691375-234691397 GACCATCATGTGCCTGGGGCGGG + Intergenic
948830489 2:240596229-240596251 GAGGCCCTTGTGCTTGCAGCAGG + Intronic
1170698717 20:18684098-18684120 GACCCTCATGTGGCTCCAGTAGG - Intronic
1171179853 20:23084502-23084524 GGCCCCCAGGAGCCTGCAGGTGG - Exonic
1171248815 20:23633794-23633816 TCTCCCCATGTGCCTGCACCAGG - Intronic
1171283240 20:23918654-23918676 TCTCCCCATGTGCCTGCACCAGG - Intergenic
1171304038 20:24089475-24089497 AATTCCCATGTGCTTGCAGCAGG - Intergenic
1172270093 20:33650196-33650218 GCACCCCATGTGCCTGGAACTGG + Intergenic
1172577005 20:36017243-36017265 GGCCTCCCTGTGCCTGCAGAGGG + Intronic
1172875155 20:38159658-38159680 CATCCCTATGTCCCTGCAGCAGG - Intronic
1174117600 20:48237938-48237960 GAGGCCCATGTGGCTGCAGCAGG - Intergenic
1174163912 20:48571209-48571231 GAGGCCCATGTGGCTGCAGCAGG + Intergenic
1174588253 20:51625227-51625249 GCCGCACATCTGCCTGCAGCTGG + Exonic
1176106461 20:63391857-63391879 TACACCCATGTGGCTGCCGCTGG + Intergenic
1176427408 21:6557337-6557359 GACTCCCCTGAGCCTCCAGCAGG + Intergenic
1178442757 21:32612180-32612202 TACTCCCAGGCGCCTGCAGCAGG + Exonic
1179702899 21:43165654-43165676 GACTCCCCTGAGCCTCCAGCAGG + Intergenic
1179727127 21:43346882-43346904 GACCACCGCCTGCCTGCAGCAGG + Intergenic
1179898709 21:44377814-44377836 GACAGTCATCTGCCTGCAGCAGG - Intronic
1180830300 22:18902341-18902363 GAGCCCCTTGAGACTGCAGCTGG + Intergenic
1183160607 22:36110554-36110576 GACCCCAATCTGCCTCCCGCTGG - Intergenic
1183461562 22:37953979-37954001 GGCCCTCCTGTGCCTCCAGCCGG - Intronic
1184616143 22:45639972-45639994 GAGCCCCAGGGGCCTGGAGCAGG + Intergenic
1184892813 22:47389951-47389973 GACCTCCATCTTCCTGCACCGGG + Intergenic
1185376275 22:50483894-50483916 GACTCACATGTGCCTGCCACTGG + Exonic
1203280389 22_KI270734v1_random:127612-127634 GAGCCCCTTGAGACTGCAGCTGG + Intergenic
952254333 3:31682417-31682439 GAAGCCCATGTGGCTGGAGCAGG - Intronic
953409551 3:42682745-42682767 GACCCCCGTGGGCCAGCATCAGG - Intergenic
953546247 3:43865593-43865615 TCCCCCCATCTGCATGCAGCAGG + Intergenic
954298817 3:49688557-49688579 GATCCCCATCTGCCTTCAGGAGG - Intronic
959105768 3:102063152-102063174 CACCCACATGTTCCTGCAGATGG - Intergenic
960861090 3:122154310-122154332 CACCCCCATGTGCCACCTGCAGG + Intergenic
961325373 3:126106222-126106244 GACCCACATGTGCCCGCCGCAGG + Intronic
967820590 3:193835601-193835623 CAGCCCCATGTGGCTGCCGCAGG - Intergenic
968502847 4:959221-959243 GCCCCCCAGGAGGCTGCAGCAGG + Exonic
968523651 4:1045794-1045816 GGCCCCCATGTCCCCGCAGAGGG - Intergenic
969574521 4:8029263-8029285 GACCCACATGAGCTTGCAGCCGG + Intronic
981538623 4:145825412-145825434 AAGCTCCATGTGGCTGCAGCAGG + Intronic
982242889 4:153318128-153318150 GACCACCAGGTGCCTGCATGAGG - Intronic
985578353 5:684080-684102 GACCCTCTCGTGCCTGCAGATGG + Intronic
985593283 5:776220-776242 GACCCTCTCGTGCCTGCAGGTGG + Intergenic
985630733 5:1012718-1012740 GAGGCTCATATGCCTGCAGCTGG + Intronic
989605997 5:43245307-43245329 GGCCCCCACGTCCCTGCTGCGGG - Exonic
997819589 5:137052970-137052992 GAACACCCTGTGCCTGCAGTTGG - Intronic
1000117950 5:158171024-158171046 GGCATCCATGTGCCTGGAGCTGG - Intergenic
1000238580 5:159387383-159387405 GTCCCCCAGCTGCCTGTAGCAGG + Intergenic
1001364257 5:171121418-171121440 GACGGCCCTGTGCCTGCAACAGG - Intronic
1001744694 5:174083225-174083247 GACTCCCATGTGCCTGGCCCAGG + Intronic
1013227398 6:108129935-108129957 AACCCCCATGTGCCTGTATTTGG - Intronic
1016742181 6:147540568-147540590 GACCCCCATAAGCTTGCAGCAGG - Intronic
1018172648 6:161154069-161154091 GACCCCCATGTGACTTCCACAGG - Intronic
1019143585 6:169962874-169962896 GAGCCCGAGGTGGCTGCAGCAGG - Intergenic
1019925820 7:4191248-4191270 GACACCCATGTGACCGCGGCGGG - Intronic
1020022229 7:4875924-4875946 CACCCCCAATTGCCTGCACCTGG - Intronic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1024089618 7:45924462-45924484 CACCTCCATGTGCCAGCTGCAGG + Intergenic
1032237845 7:130140577-130140599 CAGGCCCATGTGCCTGCCGCCGG - Intergenic
1032489435 7:132313074-132313096 CACCCCCATGTGCATCCAGGGGG - Intronic
1033186536 7:139231727-139231749 GCCGCCCATGTCGCTGCAGCGGG + Exonic
1034696153 7:153055734-153055756 GACTCCCACGTGGCTGCTGCTGG + Intergenic
1039970883 8:42320803-42320825 GAGCCCCATGGGCCGGAAGCAGG + Exonic
1041360249 8:57045470-57045492 GACCCCCAAGAGCCTCCAGGGGG + Intergenic
1042537568 8:69873961-69873983 CACCCCCAAGTGCCAGCGGCTGG - Intergenic
1048862962 8:138737284-138737306 CACCCCCATCTGCCTCCAGATGG + Intronic
1049329350 8:142042034-142042056 AACCCCCATGTGCCTGGGGGTGG + Intergenic
1051511698 9:17885903-17885925 ACCCCCTAGGTGCCTGCAGCTGG + Intergenic
1057003502 9:91534647-91534669 CACCCACCTGAGCCTGCAGCTGG + Intergenic
1057619181 9:96619659-96619681 CGCCCCCAGGTGCCCGCAGCCGG + Exonic
1057759909 9:97863606-97863628 GACCCGTCTGGGCCTGCAGCTGG + Intergenic
1057928270 9:99171417-99171439 GTCCCCCATGGTCCTCCAGCTGG + Intergenic
1059426716 9:114225802-114225824 GTCCCCCGGGTCCCTGCAGCCGG + Intronic
1060873290 9:127060122-127060144 GCCCCCCATGTGTGGGCAGCCGG - Intronic
1061735960 9:132659254-132659276 GACCCTCATGTGCCCTCAGTGGG - Intronic
1062164907 9:135102806-135102828 GAACCCCATCTGCCTGCTTCAGG + Intronic
1062210184 9:135359413-135359435 GATCCCGGTGTCCCTGCAGCTGG - Intergenic
1062478525 9:136741183-136741205 GACCCCCCTGTGCCTTGAGCAGG - Intronic
1185513116 X:677748-677770 GTACCCCATGTCCCTGCAGAGGG - Intergenic
1188877603 X:35450018-35450040 CACCCCCATGTTCCTCCAGGAGG - Intergenic
1189725947 X:43968483-43968505 AACCCCTATGTGTGTGCAGCAGG - Intronic
1189971397 X:46421372-46421394 GTCCCCCATGTGGCTGGATCCGG - Intergenic
1190735892 X:53255950-53255972 GCCCCCCATGTGGCTGCTGGAGG + Exonic
1191251024 X:58260272-58260294 GACCCCCAAGGGCCTGGTGCAGG - Intergenic
1191251635 X:58262735-58262757 GACCCCCATGGGCCCGGCGCAGG - Intergenic
1191251771 X:58263322-58263344 GACCACCGTGGGCCTGGAGCAGG - Intergenic
1191252289 X:58265402-58265424 GACCCCCTTGGGCCTGGCGCAGG + Intergenic
1192735870 X:73849335-73849357 GAACCCCATTTGCATTCAGCAGG - Intergenic
1196933508 X:120705536-120705558 GACTCCCATGTTCCTGCTGCTGG - Intergenic
1197949663 X:131880868-131880890 GATCCCCATGTGGCTTCTGCTGG - Intergenic
1199671653 X:150152729-150152751 GGGCCCCAAGTGCCTGCTGCAGG + Intergenic
1200229913 X:154438696-154438718 GCTCCCCAGGTGCCTGGAGCAGG + Intronic
1200398811 X:156006868-156006890 GGCCCCCATTGGCCTCCAGCAGG - Intronic
1201765188 Y:17568669-17568691 GACCACCCTGTGCCCGCAGCCGG + Intergenic
1201836364 Y:18337320-18337342 GACCACCCTGTGCCCGCAGCCGG - Intergenic