ID: 935949529

View in Genome Browser
Species Human (GRCh38)
Location 2:108316241-108316263
Sequence CCTAGTCAAGGGCATCAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935949517_935949529 22 Left 935949517 2:108316196-108316218 CCGTGAGAATAAGCAGCCTGACC 0: 11
1: 20
2: 29
3: 88
4: 291
Right 935949529 2:108316241-108316263 CCTAGTCAAGGGCATCAATAGGG No data
935949524_935949529 0 Left 935949524 2:108316218-108316240 CCTCGGTTTGGTCTGGGAACATG No data
Right 935949529 2:108316241-108316263 CCTAGTCAAGGGCATCAATAGGG No data
935949521_935949529 6 Left 935949521 2:108316212-108316234 CCTGACCCTCGGTTTGGTCTGGG 0: 6
1: 32
2: 78
3: 96
4: 186
Right 935949529 2:108316241-108316263 CCTAGTCAAGGGCATCAATAGGG No data
935949523_935949529 1 Left 935949523 2:108316217-108316239 CCCTCGGTTTGGTCTGGGAACAT No data
Right 935949529 2:108316241-108316263 CCTAGTCAAGGGCATCAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935949529 Original CRISPR CCTAGTCAAGGGCATCAATA GGG Intergenic
No off target data available for this crispr