ID: 935949662

View in Genome Browser
Species Human (GRCh38)
Location 2:108317133-108317155
Sequence CACCACTGCCTGCAACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935949661_935949662 2 Left 935949661 2:108317108-108317130 CCAGGAAGAAGAAAACAACAGCT No data
Right 935949662 2:108317133-108317155 CACCACTGCCTGCAACACCCTGG No data
935949659_935949662 24 Left 935949659 2:108317086-108317108 CCTTGGCAGAAAAACACTGCTGC No data
Right 935949662 2:108317133-108317155 CACCACTGCCTGCAACACCCTGG No data
935949658_935949662 25 Left 935949658 2:108317085-108317107 CCCTTGGCAGAAAAACACTGCTG No data
Right 935949662 2:108317133-108317155 CACCACTGCCTGCAACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935949662 Original CRISPR CACCACTGCCTGCAACACCC TGG Intergenic