ID: 935950331

View in Genome Browser
Species Human (GRCh38)
Location 2:108323103-108323125
Sequence GTCTGTTGGTACCTTGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935950331_935950336 2 Left 935950331 2:108323103-108323125 CCAAAATCAAGGTACCAACAGAC No data
Right 935950336 2:108323128-108323150 GGTTTCTTTCGAGGGCTGTGAGG No data
935950331_935950334 -7 Left 935950331 2:108323103-108323125 CCAAAATCAAGGTACCAACAGAC No data
Right 935950334 2:108323119-108323141 AACAGACTTGGTTTCTTTCGAGG No data
935950331_935950335 -6 Left 935950331 2:108323103-108323125 CCAAAATCAAGGTACCAACAGAC No data
Right 935950335 2:108323120-108323142 ACAGACTTGGTTTCTTTCGAGGG No data
935950331_935950337 7 Left 935950331 2:108323103-108323125 CCAAAATCAAGGTACCAACAGAC No data
Right 935950337 2:108323133-108323155 CTTTCGAGGGCTGTGAGGAAAGG No data
935950331_935950338 19 Left 935950331 2:108323103-108323125 CCAAAATCAAGGTACCAACAGAC No data
Right 935950338 2:108323145-108323167 GTGAGGAAAGGCACTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935950331 Original CRISPR GTCTGTTGGTACCTTGATTT TGG (reversed) Intergenic
No off target data available for this crispr