ID: 935952857

View in Genome Browser
Species Human (GRCh38)
Location 2:108346597-108346619
Sequence TCACCAAGATGTTTTCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935952857_935952859 -10 Left 935952857 2:108346597-108346619 CCATCAGGAAAACATCTTGGTGA No data
Right 935952859 2:108346610-108346632 ATCTTGGTGAGGAGTTGCAACGG No data
935952857_935952863 5 Left 935952857 2:108346597-108346619 CCATCAGGAAAACATCTTGGTGA No data
Right 935952863 2:108346625-108346647 TGCAACGGAGGAGCGACGGGAGG No data
935952857_935952868 23 Left 935952857 2:108346597-108346619 CCATCAGGAAAACATCTTGGTGA No data
Right 935952868 2:108346643-108346665 GGAGGTTGAGGGGAGCAACAGGG No data
935952857_935952865 12 Left 935952857 2:108346597-108346619 CCATCAGGAAAACATCTTGGTGA No data
Right 935952865 2:108346632-108346654 GAGGAGCGACGGGAGGTTGAGGG No data
935952857_935952860 -7 Left 935952857 2:108346597-108346619 CCATCAGGAAAACATCTTGGTGA No data
Right 935952860 2:108346613-108346635 TTGGTGAGGAGTTGCAACGGAGG No data
935952857_935952869 24 Left 935952857 2:108346597-108346619 CCATCAGGAAAACATCTTGGTGA No data
Right 935952869 2:108346644-108346666 GAGGTTGAGGGGAGCAACAGGGG No data
935952857_935952861 1 Left 935952857 2:108346597-108346619 CCATCAGGAAAACATCTTGGTGA No data
Right 935952861 2:108346621-108346643 GAGTTGCAACGGAGGAGCGACGG No data
935952857_935952864 11 Left 935952857 2:108346597-108346619 CCATCAGGAAAACATCTTGGTGA No data
Right 935952864 2:108346631-108346653 GGAGGAGCGACGGGAGGTTGAGG No data
935952857_935952862 2 Left 935952857 2:108346597-108346619 CCATCAGGAAAACATCTTGGTGA No data
Right 935952862 2:108346622-108346644 AGTTGCAACGGAGGAGCGACGGG No data
935952857_935952866 13 Left 935952857 2:108346597-108346619 CCATCAGGAAAACATCTTGGTGA No data
Right 935952866 2:108346633-108346655 AGGAGCGACGGGAGGTTGAGGGG No data
935952857_935952867 22 Left 935952857 2:108346597-108346619 CCATCAGGAAAACATCTTGGTGA No data
Right 935952867 2:108346642-108346664 GGGAGGTTGAGGGGAGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935952857 Original CRISPR TCACCAAGATGTTTTCCTGA TGG (reversed) Intergenic