ID: 935956487

View in Genome Browser
Species Human (GRCh38)
Location 2:108381871-108381893
Sequence ACTCACCAGATCCTAAGGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935956487_935956491 19 Left 935956487 2:108381871-108381893 CCCATCCTTAGGATCTGGTGAGT 0: 1
1: 0
2: 0
3: 4
4: 95
Right 935956491 2:108381913-108381935 TACAGTCCTAAAATGCACTTAGG 0: 1
1: 0
2: 1
3: 8
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935956487 Original CRISPR ACTCACCAGATCCTAAGGAT GGG (reversed) Exonic
904074819 1:27832084-27832106 ACCTACCAGATCCTAAGGAAAGG - Intronic
905784183 1:40739848-40739870 ATTCACCAGATGTGAAGGATGGG + Intronic
907438364 1:54463638-54463660 ACCCACCAGATCCTGCGGCTGGG - Intergenic
907537671 1:55179744-55179766 AATCACCAGGTCCTGGGGATGGG - Intronic
908454116 1:64285193-64285215 AGTCACCAGATGCTAGGGGTTGG - Intergenic
909412633 1:75373327-75373349 CCTCAACAGGTCCTAAGGAAGGG + Intronic
910551219 1:88477594-88477616 CCTCACCAGAACCTAACCATGGG + Intergenic
911687819 1:100797430-100797452 ACTGACAAGATGCTATGGATGGG + Intergenic
912887961 1:113496491-113496513 ACTCTGCAGATCCTTAGGGTGGG - Intronic
913430709 1:118788381-118788403 ACTCACCATATCCTTGGGCTGGG - Intergenic
917393426 1:174564801-174564823 ATTCTCTAGATCCTATGGATAGG + Intronic
919484004 1:198123596-198123618 CCTCACAACATTCTAAGGATGGG + Intergenic
920778999 1:208969701-208969723 ACACATCAGATCATGAGGATGGG + Intergenic
1067283071 10:44887605-44887627 ACTCACAAGATGCTAAGCACAGG - Intergenic
1070503399 10:77092162-77092184 ACTCACCATATACTAATGAGGGG - Intronic
1075183464 10:120233204-120233226 ACTCACCAGCATCCAAGGATGGG - Intergenic
1075228653 10:120651997-120652019 ACTCCCTAGCTCCTAAGGAATGG + Intergenic
1077253016 11:1568924-1568946 TCTCCCCAGATGCTAAGGATCGG + Intronic
1077614785 11:3666995-3667017 TATCCCCAGATCCTAATGATAGG - Intronic
1077616980 11:3683194-3683216 ACTCACCAGAAGCTAAGTGTCGG + Exonic
1081203083 11:40241929-40241951 AGTCACCAGATCCTCAGAAGGGG - Intronic
1093518863 12:20024255-20024277 TCTCACCAGATCACAAGGAAAGG - Intergenic
1093788597 12:23220732-23220754 ACTCAACAGTTACTAAGCATGGG + Intergenic
1094053869 12:26249013-26249035 ATTTACAGGATCCTAAGGATTGG - Intronic
1094588874 12:31802404-31802426 ACTCTCCAGACCCTTAAGATAGG + Intergenic
1095103653 12:38206838-38206860 ACCCACCAGATCCTTAACATTGG + Intergenic
1103688859 12:122753894-122753916 ACTCACCAAATGAAAAGGATGGG - Intronic
1115530254 14:34320560-34320582 AGGCAACAGATTCTAAGGATGGG - Intronic
1121617948 14:95326088-95326110 ACTCACTATTTCCCAAGGATTGG + Intergenic
1126384409 15:48078928-48078950 ACTCACCATAACCTTGGGATGGG + Intergenic
1129248104 15:74292282-74292304 ACTCACCATCTCCTATGGGTTGG + Intronic
1131702113 15:94949244-94949266 AGTCACCAGAAGCTAAGGAATGG + Intergenic
1132572603 16:650527-650549 ACCCACCAGATCTGCAGGATGGG - Exonic
1143918545 17:10312870-10312892 ACTCACCAAATCCTAGGTCTTGG - Intronic
1143978500 17:10847556-10847578 AGTGACCAGATCCTAATGAGAGG - Intergenic
1146241284 17:31229359-31229381 ACCCACCAGATCCTTAACATTGG - Exonic
1146826931 17:36031246-36031268 CCTCTCCAGATCCTGAGGCTTGG - Intergenic
1147660796 17:42115854-42115876 ACTCACCAGGAGCTGAGGATGGG + Intronic
1153759265 18:8314324-8314346 ACTCACCAGTGACTAAGGCTAGG + Intronic
1154259879 18:12821587-12821609 ACTCACCAGATCAGGAGGAGTGG + Intronic
1165521251 19:36315951-36315973 ACTCACCAGATACTCAAGATGGG + Intergenic
1168237519 19:55072582-55072604 CCTCACCACATCCTATGGAATGG - Intronic
925967211 2:9077235-9077257 CCTCACCAGATGCAAGGGATTGG - Intergenic
926628694 2:15117724-15117746 TATCACCAGCTCCAAAGGATGGG - Intergenic
935956487 2:108381871-108381893 ACTCACCAGATCCTAAGGATGGG - Exonic
936339116 2:111615873-111615895 AATCACCATCTCCTAAGGCTGGG + Intergenic
937245271 2:120488499-120488521 ACTCACTAGGTTCTAAGAATAGG - Intergenic
940855725 2:158727239-158727261 ACTCACCAGTTTCTAAGGCTGGG + Intergenic
942700883 2:178708814-178708836 ACTAACCAGATCATAAGAGTTGG + Intronic
1172598986 20:36170676-36170698 ACTCCCCAGATCCTAACTCTAGG - Intronic
1173628896 20:44495041-44495063 ACTAGCCAAATACTAAGGATGGG + Intergenic
1174540296 20:51284111-51284133 ATTCACCAGGACCTAAGGGTGGG + Intergenic
1183142187 22:35952909-35952931 ACTCACAATAGCCAAAGGATGGG + Intronic
1183176786 22:36230322-36230344 ACTCACCAGTTCCAAGGCATGGG + Intronic
949217006 3:1582816-1582838 ACTGAACAGGTCCTAAGGAAGGG + Intergenic
949652308 3:6174013-6174035 ACACACCAGACCTTTAGGATAGG + Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
954144980 3:48630056-48630078 ACTCACCAGATCCGCCCGATTGG + Exonic
956455337 3:69415328-69415350 AGTCACAAGATACTATGGATTGG + Intronic
958708079 3:97681829-97681851 ACTCAACAGTTCCTACTGATTGG + Intronic
964250536 3:154711212-154711234 CCTCATCAGATCCCATGGATGGG + Intergenic
964634134 3:158842242-158842264 ACTTACCAGGTCCAAAGGGTTGG + Intergenic
968915079 4:3493773-3493795 ACTCACCTGATCCTCAGGGGTGG - Exonic
969574139 4:8026569-8026591 ACTCAGCAGCTGCTCAGGATGGG + Intronic
970127942 4:12835422-12835444 ATTCACCCAATCCTAAGGGTGGG + Intergenic
972672525 4:41227253-41227275 ACTAAACAGATCCTAAGAACTGG + Intergenic
973656714 4:53055681-53055703 ACTCACCAGAGTCTTATGATGGG + Intronic
977551611 4:98449129-98449151 ACTCACCACATCCTGCTGATAGG + Intergenic
979161650 4:117468979-117469001 ACTCACCAGACAATAAGGAGAGG - Intergenic
987582858 5:19819532-19819554 TCTGACCAGGTCCTAAGGAAGGG + Intronic
998448486 5:142216582-142216604 CTTCAACAGTTCCTAAGGATTGG - Intergenic
1000199618 5:158995264-158995286 AATCACCTGAACCTAAGTATTGG + Intronic
1000955873 5:167542874-167542896 ACTCACAAGCTCCTAAGTTTTGG - Intronic
1001388317 5:171358244-171358266 ACCCACTAAATCCTAAGGTTAGG + Intergenic
1003249713 6:4415531-4415553 ACACAACAGATGCTAATGATAGG - Intergenic
1003610218 6:7606893-7606915 ACTGACCAGATGATAAGGAGTGG - Intronic
1006770247 6:36547184-36547206 ACTCACCAGAGCCCAGGGAGAGG + Exonic
1008331742 6:50253626-50253648 ACTCACATGACTCTAAGGATAGG - Intergenic
1009745207 6:67804377-67804399 ACTTTCCAGATCTTAAGGAAGGG - Intergenic
1010088483 6:71950538-71950560 TATCACCAAATCCTAATGATAGG - Intronic
1016893312 6:149028348-149028370 ACTCACCATATAGTAAGGCTGGG - Intronic
1019549764 7:1596108-1596130 AATCCCCAGCTCCTAAGGGTTGG - Intergenic
1022574735 7:31486586-31486608 ACTCAGCAGATCCTCGGGAGAGG + Intergenic
1024507450 7:50174281-50174303 AGTCACAATATCCTAAAGATGGG - Intergenic
1027553607 7:79634059-79634081 TCACACCAGATGTTAAGGATGGG + Intergenic
1027746888 7:82086833-82086855 ACTCAACAGCTACTAAGTATTGG + Intronic
1028177087 7:87672056-87672078 ACTCTCCAAATCCCAAAGATGGG + Intronic
1034659370 7:152756258-152756280 ATTCACCAGAGCCAAAGGTTAGG - Intergenic
1044758552 8:95492591-95492613 ACTCAGCAGGTCCTAATGTTAGG - Intergenic
1049225626 8:141449254-141449276 ACTCCCCAGAACCCAAGCATGGG + Intergenic
1053757349 9:41325283-41325305 ACACTCCAGATCCTGTGGATGGG + Intergenic
1056186187 9:84137290-84137312 ACTCACCTGATAGAAAGGATGGG + Intergenic
1060547041 9:124467940-124467962 ACCCAGCACATCCTAAGGAGAGG - Intronic
1060935752 9:127514841-127514863 ACTAGCCAGATCCTGAGTATTGG - Intronic
1061896115 9:133648723-133648745 ACTCACCAGAAGCCAAGGACAGG - Intronic
1187601824 X:20839690-20839712 CCTCAGCAGTTCCTAAGGAAGGG - Intergenic
1189928941 X:45987321-45987343 AGTCACAAGATTCAAAGGATGGG + Intergenic
1194258711 X:91667962-91667984 TATCCCCACATCCTAAGGATGGG + Intergenic
1200577472 Y:4907472-4907494 TATCCCCACATCCTAAGGATGGG + Intergenic
1201969390 Y:19774864-19774886 ACCCACCAGCTCCTAGGGACAGG + Intergenic