ID: 935964898

View in Genome Browser
Species Human (GRCh38)
Location 2:108463857-108463879
Sequence CCATATCCACAGGTGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935964898 Original CRISPR CCATATCCACAGGTGGTGCA TGG Intronic
901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG + Intronic
901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG + Intronic
904869916 1:33610419-33610441 CCACATCCACAGGTGATGGATGG + Intronic
905620018 1:39437029-39437051 CCATTTACACAGCTGGTGGAGGG + Intronic
907947630 1:59150179-59150201 CCAGTTCCACTGGTGGTGGAAGG - Intergenic
908102808 1:60808718-60808740 CTAAATCCACAGGTGGGGCAAGG + Intergenic
908156490 1:61358792-61358814 CTATCTCCACAGGTGGTGGCTGG - Intronic
908569357 1:65392603-65392625 CCACATCCTCAGGGGGTGGAGGG - Exonic
915663080 1:157419855-157419877 CCATGTCCTCAGATGGTGGAAGG - Intergenic
920945884 1:210528203-210528225 CCAGACCCAGGGGTGGTGCAGGG + Intronic
1065806433 10:29397491-29397513 CCAAATCCACAAGATGTGCAGGG - Intergenic
1068548351 10:58378260-58378282 CCAAATCAACAAGTGCTGCAGGG + Intergenic
1072737253 10:97887579-97887601 CCAGACCCAGACGTGGTGCAGGG + Intronic
1075658688 10:124178381-124178403 CAGAATCCCCAGGTGGTGCAGGG + Intergenic
1083048516 11:59756619-59756641 CCATTTCCCCAGGTGATTCATGG + Intronic
1083852116 11:65374306-65374328 CCATGTGCCCAGGTGGAGCAGGG + Intergenic
1083852123 11:65374332-65374354 CCATGTGCCCAGGTGGAGCAGGG + Intergenic
1084603647 11:70160676-70160698 GGACATCCTCAGGTGGTGCAGGG - Intronic
1084606199 11:70173557-70173579 CCATGGCCAGAGGTGGAGCAAGG + Intronic
1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG + Intronic
1093700059 12:22210255-22210277 ACATATACATATGTGGTGCATGG + Intronic
1097384488 12:58933508-58933530 CCCTATCCACAGGTGTCCCATGG + Intergenic
1101328814 12:103740710-103740732 ACAGATCCCCAGGTGCTGCAAGG + Exonic
1102162437 12:110780653-110780675 CCATCCACACAGGAGGTGCAAGG - Intergenic
1104358732 12:128112248-128112270 TCATATACACAGGGAGTGCAGGG + Intergenic
1104428415 12:128696697-128696719 CCATTTCCACATATGGTGTAAGG - Intronic
1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG + Intronic
1108238922 13:48441211-48441233 CCATGTCCTCAGATGGTGGAAGG + Intronic
1115712469 14:36066054-36066076 CCACATCCTCACGTGGTGGAAGG - Intergenic
1119805651 14:77480389-77480411 CCAAATCCTCAGGGTGTGCAGGG + Intronic
1124530285 15:30499730-30499752 CCATTTCCTCAGGCAGTGCAGGG - Intergenic
1124768374 15:32507958-32507980 CCATTTCCTCAGGCAGTGCAGGG + Intergenic
1129915558 15:79266901-79266923 CCACACCCAGAGGTGGTACAGGG - Intergenic
1130200974 15:81826510-81826532 TCACATCAACGGGTGGTGCATGG - Intergenic
1130690024 15:86074232-86074254 CTGTATCCTCAGGTGGTGAAAGG + Intergenic
1132765524 16:1532453-1532475 GTATATCCACAGGTGAAGCAAGG - Intronic
1132977759 16:2719206-2719228 CCATGTGCACAGGAGGTGGAAGG - Intronic
1139462627 16:67134717-67134739 CCGTATCCTCATATGGTGCAAGG + Intronic
1140515540 16:75538773-75538795 CCACATCCTCAGGAGGTGAATGG + Exonic
1142235476 16:88920616-88920638 CAACGGCCACAGGTGGTGCATGG + Intronic
1143594525 17:7906434-7906456 CCAAATCCCCAGGTGCTCCAGGG - Intronic
1144290808 17:13824470-13824492 CCAAATCCCCATGTGGTTCAGGG - Intergenic
1145741265 17:27276702-27276724 ACATATCCACAGGGGATGCTGGG - Intergenic
1146568132 17:33930805-33930827 GCAGACCCACAGGTGGTGGAGGG + Intronic
1152511762 17:80794800-80794822 CCATCTCCAAGGGTGGCGCATGG + Intronic
1153184260 18:2469410-2469432 CCAAAACCAGAGGTGGTTCAAGG + Intergenic
1153206863 18:2712544-2712566 TCATATACACAGGTTCTGCAGGG + Intronic
1158933477 18:62343622-62343644 CCATGTCCACAGTCTGTGCAAGG - Intronic
1161540555 19:4848463-4848485 CTATATTCACAGGTTGTCCAAGG - Intronic
1165035763 19:33032403-33032425 CCTTCTCCAGAGGTGGTGTAGGG + Intronic
1165225472 19:34351771-34351793 ACATAGCCACATGTGGTGAATGG - Intronic
1166407140 19:42529214-42529236 CCTTCCCCACAGGTGGTGCCAGG + Intronic
927210936 2:20638627-20638649 CCAGATCCCCAGGGGCTGCAGGG - Exonic
928539637 2:32272322-32272344 CTATATCCTCACGTGGTGGAAGG - Intergenic
929214240 2:39393796-39393818 TCATATACACAGGTTCTGCAGGG - Intronic
931193738 2:60029939-60029961 CCATATCCACACGGGGTGCAGGG - Intergenic
931684422 2:64781391-64781413 CCATAACAAAAGGAGGTGCAGGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936226180 2:110654939-110654961 CCATATCCACAAGTTCTGCAGGG + Intronic
943301883 2:186213065-186213087 CCATCTCATCAGGTGATGCAGGG + Intergenic
943876411 2:193072766-193072788 CCAGGCCCACAGGTGGTGCTTGG + Intergenic
946096279 2:217277224-217277246 CCGTATCCTCAGGTGGTGGAGGG + Intergenic
946364119 2:219237947-219237969 TCCTATCCACAGGTGTTCCAGGG - Exonic
1172564778 20:35920709-35920731 GCATGTCCACTGGTGGTGCTGGG - Intronic
1173870380 20:46338022-46338044 CGACATCCACAGCTGATGCAGGG + Intergenic
1174729944 20:52906255-52906277 CAATAGCCACAAGTGGTGCAGGG + Intergenic
1179722907 21:43325497-43325519 CCAGGGCCACATGTGGTGCAAGG - Intergenic
1179949750 21:44703043-44703065 CCATAGCCACAGGAGGTCCCTGG + Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184980443 22:48091739-48091761 TCATGCCCACAGTTGGTGCAGGG - Intergenic
951390128 3:22092366-22092388 CCACATCCACAGCTTTTGCAGGG + Intronic
952177977 3:30887491-30887513 CAGTATCCCAAGGTGGTGCAGGG - Intronic
952549216 3:34457094-34457116 TCATGCCCACAAGTGGTGCATGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
955216050 3:56985825-56985847 ACATACCCACAGGTGGGGCTGGG + Intronic
959349837 3:105248312-105248334 CCATGTCCTCACGTGGTGGAGGG - Intergenic
960215290 3:115026754-115026776 CAATATACACAGGTGATGAAAGG - Intronic
961779490 3:129313421-129313443 CCAGATCCCCAGGTGGTTCTGGG - Intergenic
962536918 3:136337626-136337648 CCATATCCACAGAGGGTGTGTGG + Exonic
963801708 3:149682915-149682937 CCAGAGCCACAGGAGGTTCAAGG - Intronic
965890199 3:173503770-173503792 CCATTTCCAAAGGTGCTACAGGG + Intronic
968736673 4:2300833-2300855 CCACAACCACAGGGGCTGCAGGG + Intronic
969512997 4:7630224-7630246 CCATGTCCACAGGTGAGGCTGGG + Intronic
973949174 4:55993938-55993960 CCATATCCCCAGGTTATACAAGG - Intronic
977121388 4:93106067-93106089 ACATAACAACAGGTGGTGGAAGG - Intronic
977495449 4:97769809-97769831 CCATATCCTAAAATGGTGCATGG - Intronic
982375969 4:154690977-154690999 CCATAGCCACATGTGGTGAGTGG - Intronic
983882833 4:172952312-172952334 CCATAGCCTCAGGTGGTGGGAGG + Intronic
984852664 4:184167823-184167845 GCATATCAACAGATGGTGCTGGG + Intronic
987414321 5:17647357-17647379 CCCTATCCACAGGATGTTCAAGG + Intergenic
993698352 5:91089078-91089100 CAATACCCACAGGTGTGGCAGGG - Intronic
999119583 5:149198761-149198783 CCTCATCCACAGGTGGGACAGGG + Intronic
1002174361 5:177393217-177393239 CCTTATCCTCAGGGGGTGTAAGG - Intronic
1002814698 6:668940-668962 CCATATCCATGGGTTCTGCATGG - Intronic
1011348768 6:86399978-86400000 CCATGTCCCAAGGTTGTGCAGGG + Intergenic
1017073822 6:150600098-150600120 CCACATCCGCAGGTGGGGCCGGG + Intronic
1017982529 6:159413572-159413594 CCATCTTCAGATGTGGTGCAAGG + Intergenic
1019925944 7:4191820-4191842 CCATCTCCACAGGTGTGGCCGGG + Intronic
1022320413 7:29282941-29282963 CAATATCAGCAGGTGGTGGATGG + Intronic
1023594730 7:41816945-41816967 CCAAACCCACAGGTGGTCAAAGG - Intergenic
1033163252 7:139015889-139015911 CCATTCCCACAGGAGGTGGATGG + Intergenic
1034059854 7:148077015-148077037 CCATATATACAGGCGGGGCATGG + Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1040388859 8:46932939-46932961 CCAGAGCCCCAGGTGTTGCAAGG + Intergenic
1040514540 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG + Intergenic
1041091939 8:54310150-54310172 CCAGACCCACAGGTGGTTTAAGG + Intergenic
1045036251 8:98178592-98178614 CCATATCCAGAGGTGCTTCTTGG - Intergenic
1047415070 8:124658018-124658040 CTATATCCTCACGTGGTGGAGGG - Intronic
1049050000 8:140187234-140187256 TCATATACACAGGTTCTGCAAGG + Intronic
1052159608 9:25240712-25240734 CCATTTCCACTGGTGCTACAGGG - Intergenic
1055199747 9:73646153-73646175 CCATTTCAACAGCTGGTGCCAGG - Intergenic
1055638317 9:78298524-78298546 ACATCTCCACAGCTGGAGCAGGG - Intronic
1057498027 9:95575484-95575506 CCATTCCCACGTGTGGTGCACGG - Intergenic
1059124872 9:111674866-111674888 TCATATACACAGGTTCTGCAGGG - Intergenic
1062656520 9:137606637-137606659 CCACAGCCTCAGGCGGTGCAGGG - Intronic
1186430715 X:9502012-9502034 CCACAGCCACATGTGGCGCATGG - Intronic
1189586109 X:42463602-42463624 ACATATCCACAGGTAGTCCGAGG - Intergenic
1190838731 X:54126448-54126470 TCATATACACAGGTTCTGCAGGG + Intronic
1193657526 X:84216648-84216670 CCATTACAGCAGGTGGTGCATGG + Intergenic
1197704064 X:129621381-129621403 CCATAGCCACATGTGGCTCATGG + Intergenic
1200152818 X:153959626-153959648 CCATTTCCACAGGTGGGGCCAGG + Intronic