ID: 935970566

View in Genome Browser
Species Human (GRCh38)
Location 2:108527279-108527301
Sequence CAGTCTGAGGAGAGTCAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935970566_935970574 10 Left 935970566 2:108527279-108527301 CCCGCCTGACTCTCCTCAGACTG No data
Right 935970574 2:108527312-108527334 AACTAGGACCATTTAATCCAGGG No data
935970566_935970573 9 Left 935970566 2:108527279-108527301 CCCGCCTGACTCTCCTCAGACTG No data
Right 935970573 2:108527311-108527333 AAACTAGGACCATTTAATCCAGG 0: 13
1: 25
2: 32
3: 36
4: 121
935970566_935970572 -6 Left 935970566 2:108527279-108527301 CCCGCCTGACTCTCCTCAGACTG No data
Right 935970572 2:108527296-108527318 AGACTGGGCATTAGTAAACTAGG 0: 18
1: 52
2: 34
3: 38
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935970566 Original CRISPR CAGTCTGAGGAGAGTCAGGC GGG (reversed) Intergenic
No off target data available for this crispr