ID: 935970593

View in Genome Browser
Species Human (GRCh38)
Location 2:108527416-108527438
Sequence CTGTGGACCAGTAAAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935970589_935970593 5 Left 935970589 2:108527388-108527410 CCTTTCATGCCATAGTTGGTCCA No data
Right 935970593 2:108527416-108527438 CTGTGGACCAGTAAAGAGCAAGG No data
935970587_935970593 14 Left 935970587 2:108527379-108527401 CCATGTAGACCTTTCATGCCATA No data
Right 935970593 2:108527416-108527438 CTGTGGACCAGTAAAGAGCAAGG No data
935970590_935970593 -4 Left 935970590 2:108527397-108527419 CCATAGTTGGTCCAACGTTCTGT No data
Right 935970593 2:108527416-108527438 CTGTGGACCAGTAAAGAGCAAGG No data
935970586_935970593 15 Left 935970586 2:108527378-108527400 CCCATGTAGACCTTTCATGCCAT No data
Right 935970593 2:108527416-108527438 CTGTGGACCAGTAAAGAGCAAGG No data
935970582_935970593 19 Left 935970582 2:108527374-108527396 CCCCCCCATGTAGACCTTTCATG No data
Right 935970593 2:108527416-108527438 CTGTGGACCAGTAAAGAGCAAGG No data
935970584_935970593 17 Left 935970584 2:108527376-108527398 CCCCCATGTAGACCTTTCATGCC No data
Right 935970593 2:108527416-108527438 CTGTGGACCAGTAAAGAGCAAGG No data
935970583_935970593 18 Left 935970583 2:108527375-108527397 CCCCCCATGTAGACCTTTCATGC No data
Right 935970593 2:108527416-108527438 CTGTGGACCAGTAAAGAGCAAGG No data
935970585_935970593 16 Left 935970585 2:108527377-108527399 CCCCATGTAGACCTTTCATGCCA No data
Right 935970593 2:108527416-108527438 CTGTGGACCAGTAAAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935970593 Original CRISPR CTGTGGACCAGTAAAGAGCA AGG Intergenic
No off target data available for this crispr