ID: 935982275

View in Genome Browser
Species Human (GRCh38)
Location 2:108639074-108639096
Sequence CTGGTGTTCTTAAGGAGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935982268_935982275 15 Left 935982268 2:108639036-108639058 CCGTCTCAAAAAAAAAAAAATGT 0: 180
1: 2576
2: 17134
3: 120986
4: 90118
Right 935982275 2:108639074-108639096 CTGGTGTTCTTAAGGAGATGAGG 0: 1
1: 0
2: 0
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935982275 Original CRISPR CTGGTGTTCTTAAGGAGATG AGG Intronic
900625174 1:3604705-3604727 CTGGTGATCTTGAGCAGATCAGG - Intronic
901242300 1:7702625-7702647 TTCTTGTTCTCAAGGAGATGAGG + Intronic
904799629 1:33083175-33083197 CTGTTGTTCTGAAGGAGCTTGGG - Intronic
907956135 1:59230114-59230136 CTGGTGGCCATAAGGAGAAGAGG + Intergenic
909580765 1:77231818-77231840 CTGGTGTCCTTAATAAGAGGAGG + Intergenic
912035726 1:105310221-105310243 CTGGTGTCTTTATGGAGATGTGG - Intergenic
912579916 1:110711282-110711304 CTGGTGTTCTTATAAAGAAGAGG - Intergenic
912942708 1:114059170-114059192 CTGGTGGTGGTAAGGGGATGGGG + Intergenic
914229198 1:145749447-145749469 CTGGTTTGGGTAAGGAGATGAGG - Intronic
915604112 1:156940084-156940106 CTGGTGTGCTTGAGGAGAGATGG - Intronic
916869459 1:168896940-168896962 CTGTGGTTCTTAAGGAAAAGTGG - Intergenic
920276060 1:204805279-204805301 TTGGTTTTTTTAAAGAGATGGGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
1065636398 10:27740685-27740707 CTGCTGGGCTTAAGGAGAGGAGG - Intronic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1068913889 10:62407521-62407543 CTGGTGTTTTTAAGGGGATCAGG - Intronic
1070939378 10:80329867-80329889 CTGTTTTTATTAAGGATATGGGG - Intergenic
1072257742 10:93636600-93636622 CTGGTTTTTTTAAAGAGGTGTGG - Intronic
1072961045 10:99929508-99929530 CTTGTGTTCTTAAGGAGCCCGGG - Intronic
1075059043 10:119241849-119241871 CTGGAGTTCATAGGGAAATGTGG + Intronic
1075389233 10:122080537-122080559 CTGGTGTTCTTTATAAGAAGAGG - Intronic
1076152641 10:128175144-128175166 CTGGTGTTCCAAAGGCCATGAGG + Intergenic
1076730119 10:132434254-132434276 CTGGTGGGCTTTGGGAGATGAGG - Intergenic
1078076124 11:8162519-8162541 CTGTCATTCTTAAGGAGATTGGG - Intronic
1078196573 11:9141825-9141847 CAGGTGCCCTTAGGGAGATGAGG - Intronic
1081822914 11:46017601-46017623 TTGGTTTTTTTGAGGAGATGAGG - Intronic
1082789386 11:57336656-57336678 CTGGTGGTGTTAAGGAGGTCTGG - Intergenic
1089309603 11:117548976-117548998 CTGGTTCTCATAAGGGGATGTGG + Intronic
1091146049 11:133281306-133281328 GTGCTGTTCTTAAGGTAATGTGG + Intronic
1091589207 12:1833506-1833528 CTGGTGTTGATGAGGAGGTGTGG - Intronic
1091893782 12:4083985-4084007 CTGGAGTTATTAAGGAAAGGGGG - Intergenic
1092941808 12:13416461-13416483 ATGGGGTTCTTTATGAGATGTGG + Intergenic
1094180177 12:27584239-27584261 CTGGTGTTCCTGAGGTAATGAGG - Intronic
1094784418 12:33829902-33829924 CTGGTTTTCTTGAGGATGTGGGG - Intergenic
1099142969 12:79002750-79002772 CTATTGTTGTTAAGGAGATGAGG + Intronic
1099334923 12:81343414-81343436 CTGGTAGTGTTAAGGAGAAGAGG + Intronic
1100708677 12:97229809-97229831 CTGGTGTTCTTAAGCACAGAAGG - Intergenic
1102679383 12:114680681-114680703 CTGGCGTTCTAAAAGAAATGGGG - Intronic
1103824689 12:123728257-123728279 CTTTTTTTCTTAAGGAGATGGGG + Intronic
1104277708 12:127344920-127344942 CTGGAGGTGTCAAGGAGATGGGG - Intergenic
1104365541 12:128173299-128173321 CTGGAGTCCTGGAGGAGATGTGG - Intergenic
1104458939 12:128938503-128938525 CTGGTCATCTGAAGGAGCTGGGG + Intronic
1104662414 12:130620704-130620726 CTGGTGTCCTTACAGAGAGGGGG - Intronic
1107423162 13:40268548-40268570 CTGGGGTCCTTAAGGAGAGCTGG - Intergenic
1108291963 13:48971075-48971097 CTGGTGGTTTTAAAGAGAGGTGG + Intergenic
1109092458 13:58065684-58065706 CTTGTGTAGTTGAGGAGATGAGG + Intergenic
1109105093 13:58240152-58240174 CTGCTGCGCTTAAGGAGCTGAGG - Intergenic
1112006746 13:95260104-95260126 CTGATGTTCTCCAGGTGATGCGG + Intronic
1112973264 13:105286612-105286634 TTGGTGTTGTTCAGGAGCTGGGG - Intergenic
1113375051 13:109757527-109757549 CTCGAGTTCATAAGGAGATGTGG - Intronic
1113627493 13:111857631-111857653 CTGGTGGTCCTTAGGGGATGGGG + Intergenic
1116516181 14:45809012-45809034 CTGGTGTTCTGAATGAGAATTGG + Intergenic
1117887046 14:60375420-60375442 CTGGAGTTTTTAAGGGAATGTGG - Intergenic
1117893271 14:60450122-60450144 CTGCTTTTCTTAAACAGATGGGG - Intronic
1121227144 14:92329255-92329277 CGGAGGTTCTTAAGGAGATGTGG - Intronic
1128033839 15:64505786-64505808 CTGGTGTTTTAAATGAGAAGTGG - Intronic
1129359171 15:75013660-75013682 CTAGTTTTTTTAAAGAGATGGGG - Intronic
1129466793 15:75728605-75728627 CTGTTGGTCTTGAGGAGGTGAGG + Intergenic
1131638507 15:94263572-94263594 CTGGTGTTCCTAAGGACAGAAGG - Intronic
1137831361 16:51546319-51546341 CTGGGGTCCTTAAGCTGATGTGG - Intergenic
1139476293 16:67204141-67204163 CTGGTGTTCTGAAGGGGGTGGGG + Intergenic
1140911116 16:79453838-79453860 CTGGACATCTTAAGAAGATGTGG + Intergenic
1141125578 16:81398326-81398348 CTGGTGATATTGAGGAAATGAGG - Intergenic
1144663396 17:17086173-17086195 CTTGTGTTCACAAGGAGAAGCGG + Intronic
1146701028 17:34960581-34960603 TTTCTGTTCTTAAGGAGATGTGG - Intronic
1148797467 17:50203897-50203919 CTGGGGTTCTGAAGGATATTTGG + Intergenic
1155522032 18:26677961-26677983 CTGGTGTCCTTAAAGAGAGCAGG + Intergenic
1155890349 18:31260693-31260715 TTGGTGTTTTAATGGAGATGGGG - Intergenic
1158993803 18:62896604-62896626 TTGTTGTTTTTAAAGAGATGGGG + Intronic
1161993717 19:7699590-7699612 CTGGTGTGAGTAAGGAGGTGAGG - Intronic
1162619661 19:11831641-11831663 CTTGTGTTCTAAAGGAGGGGCGG - Exonic
1162800185 19:13105752-13105774 TTGGTTTTTTTAAAGAGATGGGG + Intronic
1163272997 19:16265476-16265498 CTGGTGTGCAGGAGGAGATGGGG + Intergenic
1166932225 19:46308379-46308401 CTGGTGTTCCACAGGAGGTGGGG - Intronic
925179577 2:1808346-1808368 CTGGTGTTCCTAAGGGCAGGGGG - Intronic
925800475 2:7594388-7594410 GGGGTGTTCTAAAGTAGATGGGG - Intergenic
926345349 2:11939932-11939954 TTGCTGGTCTCAAGGAGATGGGG - Intergenic
926774788 2:16411237-16411259 ATGATGTTCTTGAGTAGATGGGG - Intergenic
927345738 2:22037079-22037101 CTGGACTTCTTGAGGAGATTTGG + Intergenic
927785650 2:25972627-25972649 CTGGTGTCCTTGGGGACATGTGG + Intronic
928979126 2:37120244-37120266 TTGGGGTTCTTAAGAAGATAAGG - Intronic
932012112 2:67989030-67989052 CAGGTGGTCTTTAGGAAATGGGG - Intergenic
935982275 2:108639074-108639096 CTGGTGTTCTTAAGGAGATGAGG + Intronic
938255362 2:129855198-129855220 CTGGTGTCCTTAATAAGAAGAGG - Intergenic
939392854 2:141591237-141591259 ATGCTGTTCTTAGGGACATGGGG - Intronic
939697100 2:145340237-145340259 CTGGTGTTTACAAGCAGATGGGG + Intergenic
939712221 2:145536606-145536628 CTGGTGTCTCTAAGGGGATGTGG - Intergenic
940263519 2:151811125-151811147 TTGGTGGTCATAAGGAAATGAGG + Intronic
940538921 2:154985315-154985337 CTGGAGTTCTGAAGAAAATGAGG - Intergenic
940811174 2:158244542-158244564 GTGGTGGCCTCAAGGAGATGAGG - Intronic
940861566 2:158775374-158775396 TTGTTTTTCTTATGGAGATGGGG - Intergenic
941308228 2:163897395-163897417 TTGGTTTTCTTAAGTGGATGAGG - Intergenic
941310857 2:163929200-163929222 CTGGTATTTTTAAGGGGAAGGGG + Intergenic
943881751 2:193154404-193154426 CTGGTATTCTTATAGAGAGGGGG - Intergenic
945727845 2:213494814-213494836 CTGGTGTCATTGAGGAGATAGGG - Intronic
946599297 2:221342006-221342028 CTCATGTTCTTACGTAGATGTGG + Intergenic
946605689 2:221401570-221401592 GCGGTGTGCTTAAGGAGAAGAGG + Intergenic
947307997 2:228768344-228768366 CTGCTGTTCTTATGGTAATGAGG - Intergenic
948788154 2:240363789-240363811 CTGCTGTCCTTGGGGAGATGTGG - Intergenic
1169042520 20:2508185-2508207 CTGGGGTTTTTAGGGAGGTGAGG - Intronic
1169074900 20:2754508-2754530 CTGTTGTCTTAAAGGAGATGAGG + Intronic
1171273959 20:23839180-23839202 CTGATGTTCATCAGGAGATTTGG - Intergenic
1171427046 20:25055718-25055740 CTGGTATTCTTGAGGGGGTGAGG + Intronic
1172558383 20:35863799-35863821 ATGGGCTTCTGAAGGAGATGGGG + Intronic
1176174052 20:63709463-63709485 TTTGTGTTTTTAAGGAGATGGGG - Intronic
1177853628 21:26377572-26377594 CTGGGCTTCTTAAAGAAATGGGG + Intergenic
1179335291 21:40445735-40445757 AAGGTTTTCTGAAGGAGATGAGG - Intronic
1181409137 22:22705810-22705832 TTGGAGTCCTGAAGGAGATGTGG + Intergenic
1183774229 22:39952590-39952612 CTGGTGTCACTAAGGACATGTGG - Intronic
949127970 3:469409-469431 CTGGCATTCTTAAGCACATGTGG - Intergenic
949383300 3:3469620-3469642 GCAGTGATCTTAAGGAGATGAGG - Intergenic
950046117 3:9949501-9949523 CTGGTGGTCTGAGGGAGAAGTGG + Exonic
950396456 3:12737746-12737768 CTCTTGTTCTTAAGGAGAAGTGG - Exonic
951208676 3:19950165-19950187 ATGGTGTGCTTGAGCAGATGAGG + Intronic
953432074 3:42848033-42848055 CTGCTTTTCCTAATGAGATGTGG - Intronic
955023507 3:55144441-55144463 TTGGTGTTCCTAGGGATATGAGG + Intergenic
955388618 3:58501122-58501144 CTGAAGTTCTTAAGAAGTTGAGG - Exonic
956487442 3:69738022-69738044 CTGGAGTTCTCAAGGTGATTTGG - Intergenic
958028598 3:88078775-88078797 ATGGTATTCTTAGGGAGATGGGG + Intronic
962958265 3:140286291-140286313 GTGGTGTTTTCAAGGAGATCTGG + Intronic
964484416 3:157173427-157173449 CAGGTGTTTTTTAAGAGATGAGG - Intergenic
968515939 4:1015647-1015669 CTGGTGCTGTTAAGGGGCTGAGG + Intronic
970787457 4:19816164-19816186 CAGGTGGTCTCCAGGAGATGAGG + Intergenic
973550917 4:52035418-52035440 CTGGAGTTGTTAGGGAAATGGGG + Intronic
975190887 4:71460727-71460749 CTGATATTCTGAAGGAGAAGGGG + Intronic
976668055 4:87621514-87621536 CTGGTGTTCTCAGGGTGATTGGG - Intergenic
979622026 4:122808869-122808891 TTGGTATTCTTGTGGAGATGTGG - Intergenic
980744508 4:136998133-136998155 CTGGAGTACTAGAGGAGATGAGG - Intergenic
982323071 4:154100461-154100483 CTGATTTTTTTAAAGAGATGGGG - Intergenic
982722327 4:158871347-158871369 CTGATTTTCTTAATGCGATGAGG - Intronic
984298998 4:177890864-177890886 CAGGTGTACATAAGGAGGTGGGG + Intronic
984846693 4:184114477-184114499 CCGGAGTTCTTAAGGAAAGGAGG + Intronic
984846764 4:184115059-184115081 CCGGAGTTCTTAAGGAAAGGAGG + Intronic
986770356 5:10967157-10967179 CTAGTGTGCTTAGGGAGTTGGGG - Intergenic
986770537 5:10968903-10968925 CTAGTGTGCTTAGGGAGTTGGGG + Intergenic
990519273 5:56562405-56562427 GGGGTGTGCTCAAGGAGATGGGG - Intronic
992069168 5:73134107-73134129 CTGGTGTTTTCCAGGAGCTGAGG - Intergenic
992748729 5:79842915-79842937 ATGGGGTCCCTAAGGAGATGCGG - Intergenic
993037976 5:82778231-82778253 CTGGGGCTCTGAAGGAGCTGTGG + Intergenic
995415941 5:111913324-111913346 CAGGTGTTTTTCAGGAGATAAGG + Intronic
997951591 5:138246714-138246736 CTGTTGTTATTTAGGATATGGGG + Intergenic
998017941 5:138747456-138747478 TTTGTATTTTTAAGGAGATGGGG + Intronic
998524402 5:142829104-142829126 CTGGTGGTGATAAGGAGAGGAGG + Intronic
1004049071 6:12056317-12056339 ATGATGTTCTTAAGGAAAAGTGG + Intronic
1004405230 6:15326986-15327008 TTGTTGTTCTTGAGGAAATGAGG + Intronic
1004727858 6:18327900-18327922 CTGGAGTTTTGAAGGGGATGCGG + Intergenic
1006315184 6:33287285-33287307 CTGGGGTCCTAAAGGAGAGGTGG + Intronic
1008097533 6:47354828-47354850 TTGGTGTTCTTACCGAGATTTGG - Intergenic
1012358788 6:98350538-98350560 CTTGTGTGTTTCAGGAGATGAGG - Intergenic
1013028356 6:106303888-106303910 CTGGTGTTCTTAATTTTATGGGG - Intronic
1020443467 7:8243682-8243704 CTTGTCTGCTTAAGGAGATTTGG - Intronic
1024347372 7:48326785-48326807 CTTGTGGTATGAAGGAGATGTGG + Intronic
1026644334 7:72154733-72154755 CTGGTGTCCTTAATAAGAAGAGG + Intronic
1032099976 7:128967246-128967268 TGGGGGTTCTTAAGGAGGTGTGG - Intronic
1033175314 7:139118434-139118456 CAGGTGTTCTACAGGAGATATGG + Intergenic
1034462030 7:151203336-151203358 CTGGAGTCTTTCAGGAGATGGGG + Intronic
1035839859 8:2799666-2799688 TTGGTGTTCTCAAGAAGCTGAGG - Intergenic
1041265384 8:56059436-56059458 CTGTTTTTCTAAATGAGATGGGG - Intergenic
1041488346 8:58404059-58404081 CTGGTGTTCCTAAGTACAAGAGG + Intergenic
1045458749 8:102408611-102408633 TAGGTCTTCTTAAGGTGATGTGG - Intronic
1048745136 8:137606124-137606146 ATGGTGTTAATAAGGTGATGAGG + Intergenic
1049819212 8:144624442-144624464 CTGGTCTTCAGAAGGAGATTGGG - Intergenic
1051221046 9:14848698-14848720 CTGCTGTTCTGATGGAGATGTGG + Exonic
1051873033 9:21761133-21761155 GTGATGTTCTTAAGCAGCTGTGG + Intergenic
1052418841 9:28214980-28215002 CTTGTTTTTTTAAGGACATGGGG + Intronic
1054451575 9:65406160-65406182 CTGGGGTTTTTAAGGGGATCTGG + Intergenic
1055131404 9:72779070-72779092 CTGCTGTGCTGAAGGAGCTGAGG - Intronic
1057055600 9:91958231-91958253 CTGGGTTTCTTTAGGAAATGGGG + Intergenic
1057127047 9:92625248-92625270 CTAGTGTTCGCAAGGACATGGGG + Intronic
1058687885 9:107493607-107493629 CTGGAGTTCACAAGGAGATGAGG - Intergenic
1061285722 9:129621347-129621369 TTGTTGTTGTTAAAGAGATGGGG + Intronic
1061622558 9:131821032-131821054 CTGGGGTTTTTATGGAGATCTGG - Intergenic
1192406012 X:70887180-70887202 CTGCTTTTCTTAAGCAGAAGGGG - Intronic
1192946110 X:75966901-75966923 GTGGGGTTTTTAAGGGGATGAGG + Intergenic
1193251547 X:79296960-79296982 TTGGTGTCCTGAAAGAGATGAGG + Intergenic
1198085498 X:133278504-133278526 CTAATTTTCTTAAAGAGATGGGG - Intergenic
1198495506 X:137188195-137188217 CCAGTGTTCTTGAGGAAATGAGG - Intergenic
1199641792 X:149869198-149869220 GTGGTGTCCTAATGGAGATGGGG - Intergenic
1200940494 Y:8775239-8775261 CTTGTGCTCTTAAGGGAATGCGG + Intergenic
1202181849 Y:22146519-22146541 CTTGTGTAATTAAGGAAATGTGG + Intergenic
1202209511 Y:22439883-22439905 CTTGTGTAATTAAGGAAATGTGG - Intergenic