ID: 935987471

View in Genome Browser
Species Human (GRCh38)
Location 2:108688816-108688838
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 3, 1: 0, 2: 3, 3: 26, 4: 247}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935987462_935987471 14 Left 935987462 2:108688779-108688801 CCAGGCTGCTACCCCCATTTACC 0: 3
1: 0
2: 1
3: 16
4: 112
Right 935987471 2:108688816-108688838 CACACACAGCGGCCCCCAGCAGG 0: 3
1: 0
2: 3
3: 26
4: 247
935987467_935987471 -7 Left 935987467 2:108688800-108688822 CCCCAGCTGTTGATAACACACAC 0: 3
1: 0
2: 1
3: 12
4: 128
Right 935987471 2:108688816-108688838 CACACACAGCGGCCCCCAGCAGG 0: 3
1: 0
2: 3
3: 26
4: 247
935987461_935987471 15 Left 935987461 2:108688778-108688800 CCCAGGCTGCTACCCCCATTTAC 0: 3
1: 0
2: 0
3: 8
4: 112
Right 935987471 2:108688816-108688838 CACACACAGCGGCCCCCAGCAGG 0: 3
1: 0
2: 3
3: 26
4: 247
935987464_935987471 2 Left 935987464 2:108688791-108688813 CCCCATTTACCCCAGCTGTTGAT 0: 3
1: 1
2: 0
3: 14
4: 228
Right 935987471 2:108688816-108688838 CACACACAGCGGCCCCCAGCAGG 0: 3
1: 0
2: 3
3: 26
4: 247
935987465_935987471 1 Left 935987465 2:108688792-108688814 CCCATTTACCCCAGCTGTTGATA 0: 3
1: 0
2: 1
3: 7
4: 110
Right 935987471 2:108688816-108688838 CACACACAGCGGCCCCCAGCAGG 0: 3
1: 0
2: 3
3: 26
4: 247
935987468_935987471 -8 Left 935987468 2:108688801-108688823 CCCAGCTGTTGATAACACACACA 0: 3
1: 0
2: 2
3: 14
4: 200
Right 935987471 2:108688816-108688838 CACACACAGCGGCCCCCAGCAGG 0: 3
1: 0
2: 3
3: 26
4: 247
935987463_935987471 3 Left 935987463 2:108688790-108688812 CCCCCATTTACCCCAGCTGTTGA 0: 3
1: 0
2: 1
3: 11
4: 126
Right 935987471 2:108688816-108688838 CACACACAGCGGCCCCCAGCAGG 0: 3
1: 0
2: 3
3: 26
4: 247
935987469_935987471 -9 Left 935987469 2:108688802-108688824 CCAGCTGTTGATAACACACACAG 0: 3
1: 0
2: 2
3: 12
4: 163
Right 935987471 2:108688816-108688838 CACACACAGCGGCCCCCAGCAGG 0: 3
1: 0
2: 3
3: 26
4: 247
935987466_935987471 0 Left 935987466 2:108688793-108688815 CCATTTACCCCAGCTGTTGATAA 0: 3
1: 0
2: 0
3: 12
4: 180
Right 935987471 2:108688816-108688838 CACACACAGCGGCCCCCAGCAGG 0: 3
1: 0
2: 3
3: 26
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900497142 1:2980909-2980931 CACCCCCAGCTGCCGCCAGCCGG - Intergenic
900977675 1:6027204-6027226 CACACACTGTGTCCCCCAGGAGG - Intronic
901155885 1:7137857-7137879 AAGACACAGCAGCCCCCAGATGG - Intronic
902372820 1:16016499-16016521 CACACACAGCGCCCGCCCACAGG - Intronic
902858997 1:19231178-19231200 CAAACACAGCGGCCCGGAGATGG - Intronic
902905654 1:19554865-19554887 CATACACAGCGGCTCACACCTGG + Intergenic
904473021 1:30747573-30747595 CAAACACAGCTTCCCCAAGCTGG + Intronic
905390500 1:37633271-37633293 CACACTCAGCAGCTCCCAGCGGG - Intronic
912750338 1:112282327-112282349 CACAGACAGCGGGGGCCAGCTGG + Intergenic
913430472 1:118785620-118785642 CACACAAAACTGCCCCAAGCTGG - Intergenic
914916848 1:151824279-151824301 CACACACAGCCCCACCCAGGCGG - Intronic
915249112 1:154576092-154576114 CACACACAGCAGCTCCAACCTGG + Exonic
915249655 1:154579093-154579115 AAGACACAGCAGCCCCCAGGTGG + Exonic
919487169 1:198159012-198159034 CACACACACCGGCCCCGAGAAGG - Intronic
922738371 1:228001980-228002002 CACACACAGCCTCCCACAGAGGG + Intergenic
924511410 1:244731276-244731298 GACACACAGCGTCCACGAGCAGG + Intergenic
1063787937 10:9407220-9407242 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787943 10:9407247-9407269 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787949 10:9407274-9407296 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787959 10:9407328-9407350 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787974 10:9407409-9407431 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787980 10:9407436-9407458 TACACACAGAGCGCCCCAGCGGG + Intergenic
1064247987 10:13684462-13684484 CACACCCAGCTGTCCCCGGCTGG - Intronic
1067176700 10:43955079-43955101 CATACACAGCAACCCCCAGCTGG + Intergenic
1067189402 10:44057020-44057042 CCCTCACAGCTGCACCCAGCGGG - Intergenic
1067251371 10:44589727-44589749 AACACACAGCGCCCCCAAGGTGG + Intergenic
1069621953 10:69842829-69842851 CTCACACAGCGGAACCCAGCAGG - Intronic
1069692664 10:70364064-70364086 CTCACACAGCAGCTCCCAGATGG - Intronic
1069867573 10:71513208-71513230 CACACTGAGCAGCCCCAAGCAGG - Intronic
1073124216 10:101139898-101139920 CAAACACAGCAGCCCCAAGCTGG + Intergenic
1074462539 10:113651501-113651523 CACACACTGGGGCCCACAGAGGG - Intronic
1075705745 10:124499310-124499332 AACACACAGCCCCCTCCAGCAGG + Intronic
1075747311 10:124736766-124736788 GACACACAGCGGCCCCAGACAGG + Intronic
1075784879 10:125042291-125042313 TGCACACAGCGGCCTCCAGCTGG + Intronic
1075787026 10:125057003-125057025 TACACAGGGCAGCCCCCAGCCGG + Intronic
1076334438 10:129696044-129696066 GACACACAGCAGACACCAGCAGG - Intronic
1077030271 11:462349-462371 CACACGCAGGGGCTCCCTGCTGG - Intronic
1077032549 11:476052-476074 CACCCACAGAGGCCCTGAGCAGG + Intronic
1077319965 11:1936701-1936723 CACACACAGCAGCCCGTAGCTGG - Intronic
1077518996 11:3020129-3020151 CACACAGAGCGGCCCTCTGCTGG + Intronic
1081809918 11:45908921-45908943 GGCACACAGCGGCCCCTTGCAGG + Intergenic
1081917388 11:46741413-46741435 CTCACACAGCAGTTCCCAGCTGG + Intergenic
1083624960 11:64067636-64067658 CACACACAGGGTCCCCAAGCAGG + Intronic
1083707104 11:64524322-64524344 CACACCCAACCTCCCCCAGCAGG + Intergenic
1083897830 11:65629023-65629045 CCCACAGAGGGGCCCACAGCAGG + Intronic
1084438099 11:69155731-69155753 CATACACAGCTGCTCCCATCTGG + Intergenic
1084788695 11:71459399-71459421 CACACACAGAGGCCTCCATAGGG - Intronic
1087042840 11:93818719-93818741 CACACAGAGAGGCCACCAGCAGG - Exonic
1087196106 11:95305655-95305677 CACACACACAAGCCTCCAGCTGG - Intergenic
1088250645 11:107858556-107858578 CACTCTCTGAGGCCCCCAGCAGG - Intronic
1088588358 11:111379502-111379524 CACACACAGCAGGTCCCCGCGGG - Exonic
1088599516 11:111462396-111462418 CACACACAGCAGCCCAGAGCGGG + Intergenic
1092223517 12:6731354-6731376 CAGACAGAGCGACCCCCATCAGG - Exonic
1096210822 12:49764207-49764229 CACAGACAGCTACCCCCAGAAGG + Exonic
1097053751 12:56238388-56238410 CACACATAGATGCCCACAGCGGG + Exonic
1098113237 12:67146329-67146351 CACAGACAGTGGCCCCAACCAGG - Intergenic
1100796683 12:98189358-98189380 CTCTCAGAGGGGCCCCCAGCGGG - Intergenic
1103271790 12:119679707-119679729 CACACACCGATGCCTCCAGCAGG + Intronic
1103405250 12:120670417-120670439 CACACCCAGAGCTCCCCAGCAGG - Intergenic
1104571081 12:129926636-129926658 CAGAGACTGAGGCCCCCAGCAGG - Intergenic
1104581218 12:130012159-130012181 CACACACAGGGGCCCCTGGATGG - Intergenic
1104747043 12:131217013-131217035 CACACACAGCGGTCTACACCGGG + Intergenic
1104785575 12:131446172-131446194 CACACACAGCGGTCTACACCGGG - Intergenic
1104842246 12:131830710-131830732 CAGACAGAGCTGCACCCAGCAGG + Intronic
1105780515 13:23701954-23701976 CAGACACAGCGGCCAGCAGCTGG + Intergenic
1108541838 13:51452830-51452852 CACACACAGGGGCCGGGAGCGGG - Exonic
1110766774 13:79288725-79288747 CACACCCACCAGCCCCGAGCAGG + Intergenic
1110985086 13:81956813-81956835 CACACACACTGGTCCCCAGTTGG - Intergenic
1112339886 13:98544311-98544333 CAGACACAGAAGTCCCCAGCAGG + Intronic
1112940321 13:104854209-104854231 AACACACAGCCGACCTCAGCTGG + Intergenic
1113205916 13:107915850-107915872 CAAACACAGCCGACCCCATCTGG + Intergenic
1113617738 13:111693034-111693056 CACAAACACCTGCCCCCAGAGGG + Intergenic
1114526694 14:23371006-23371028 CACACCCTGTGGCCCTCAGCAGG + Intergenic
1115411984 14:33085536-33085558 CATTCACAGTGGCCCCCAGTGGG + Intronic
1117615493 14:57529814-57529836 CAGACACAGAGGTGCCCAGCAGG - Intergenic
1119425539 14:74532425-74532447 CACACACAGCGGCTCCGCGATGG + Exonic
1119472512 14:74908801-74908823 CACACTCAGTGGCACCCACCAGG + Intronic
1122070197 14:99201050-99201072 GACACACAGCACCCCCCACCAGG + Intronic
1122201455 14:100125097-100125119 CACACACACCTGCCCCAAGGCGG + Intronic
1122201468 14:100125187-100125209 CACACACACCTGCCCCAAGACGG + Intronic
1122774905 14:104112823-104112845 CACGCACAGCTGCCCCCGGAAGG - Exonic
1122785607 14:104162045-104162067 CAGACACAGCAGCCCCCATCTGG - Intronic
1125444972 15:39744804-39744826 CACACACAGTTCCCCACAGCTGG + Intronic
1125756262 15:42067178-42067200 CACACACACCTGGCCCCAGGTGG - Intronic
1127084064 15:55408350-55408372 CATGCACTGCGGCGCCCAGCCGG - Intronic
1127860544 15:62990031-62990053 CACTCACAGCAGCCCACACCGGG + Intergenic
1129865239 15:78902422-78902444 CACACCCAGTGGCCCCCCCCAGG - Intergenic
1130563426 15:84976196-84976218 CTCACTCAGCGGGTCCCAGCGGG - Intergenic
1132119945 15:99167982-99168004 CTCGAACAGCAGCCCCCAGCAGG - Intronic
1132575004 16:660199-660221 CAAGCACAGAGGCCCCCCGCAGG + Intronic
1132588374 16:715816-715838 CGCACGCAGCGGCCCCCTGCCGG - Exonic
1132868716 16:2106101-2106123 CGACCACAGCGGCTCCCAGCTGG + Exonic
1133079141 16:3305050-3305072 CAGAAACAGCGGCCCCCCGAGGG - Intronic
1134522869 16:14926558-14926580 CGACCACAGCGGCTCCCAGCTGG - Intronic
1134549758 16:15133500-15133522 CGACCACAGCGGCTCCCAGCTGG + Intronic
1134710537 16:16325209-16325231 CGACCACAGCGGCTCCCAGCTGG - Intergenic
1134718707 16:16369497-16369519 CGACCACAGCGGCTCCCAGCTGG - Intergenic
1134949065 16:18343436-18343458 CGACCACAGCGGCTCCCAGCTGG + Intergenic
1134956048 16:18382662-18382684 CGACCACAGCGGCTCCCAGCTGG + Intergenic
1136292774 16:29285724-29285746 CACACACCGTGGCCCCCAAGCGG + Intergenic
1136775608 16:32870284-32870306 CACACACAGACGTCTCCAGCAGG - Intergenic
1136895009 16:33991228-33991250 CACACACAGACGTCTCCAGCAGG + Intergenic
1139367130 16:66440431-66440453 CACAAACAGAAGCACCCAGCAGG - Intronic
1139472878 16:67187589-67187611 CACGCACAGCAGCCACCAACAGG + Exonic
1141570350 16:84930209-84930231 CACACACAGGGGCCCCAGCCGGG - Intergenic
1141652395 16:85400027-85400049 CAAACACAGGGGCCTCCTGCAGG + Intergenic
1141918437 16:87118172-87118194 TCCCCCCAGCGGCCCCCAGCAGG + Intronic
1142034015 16:87852624-87852646 CACACACAGAGGCTCAGAGCTGG - Intronic
1142098662 16:88259728-88259750 CACACACCGTGGCCCCCAAGCGG + Intergenic
1142186999 16:88699352-88699374 CCCACACATCGCCTCCCAGCAGG - Intronic
1142236680 16:88925725-88925747 CACACGCAGGGGCTCCCGGCGGG - Intronic
1142287849 16:89178702-89178724 TTCATACAGCGGCCCCCAACTGG - Intronic
1203078026 16_KI270728v1_random:1132393-1132415 CACACACAGACGTCTCCAGCAGG - Intergenic
1203143045 16_KI270728v1_random:1781442-1781464 CACACTCAGCGTCCTCCATCAGG - Intergenic
1142496810 17:310376-310398 CACACACACGCGCCCCCAGCAGG - Intronic
1142614684 17:1127466-1127488 GAGGCACAGCGGCACCCAGCTGG + Intronic
1145263790 17:21369751-21369773 CACAGACAGAGGCCCCGAGAGGG + Intergenic
1145940373 17:28740488-28740510 GTCCCACAGCTGCCCCCAGCAGG + Exonic
1146519804 17:33517544-33517566 CAAATACTGCAGCCCCCAGCTGG - Intronic
1147141977 17:38465206-38465228 CACACTCAGCCCCCTCCAGCTGG - Intronic
1147320108 17:39640813-39640835 CACACACTTCTCCCCCCAGCCGG - Intronic
1147589053 17:41669533-41669555 CAGCCACACCAGCCCCCAGCTGG - Intergenic
1147852637 17:43453711-43453733 CACACGCAGCTGCACACAGCTGG - Intergenic
1148442295 17:47717602-47717624 CACACACAGAGGCCAGCACCAGG - Intergenic
1152161495 17:78671194-78671216 CACACATAGGGGCCCACAGCGGG + Intergenic
1152637552 17:81436306-81436328 CACCCGCAGCTGCCCCCAGAGGG + Intronic
1152865348 17:82719255-82719277 CCCTCACACCAGCCCCCAGCTGG + Intronic
1158253534 18:55517817-55517839 CACACACAGCAGCTCCAATCAGG + Intronic
1158543556 18:58377636-58377658 CACACATACCTGCCCCCACCGGG + Intronic
1158559586 18:58502858-58502880 CACCCAGAGCAGCCGCCAGCTGG + Intronic
1158969708 18:62655227-62655249 CACAGACAGTGGCCCCAACCAGG - Intergenic
1159005331 18:63005478-63005500 CACCCACTGCAGCCGCCAGCAGG + Intergenic
1160186352 18:76679411-76679433 CAGCCACAGGGGCTCCCAGCAGG + Intergenic
1160701040 19:507557-507579 CACGGACAGCGGCCGCCAGTCGG + Exonic
1160751472 19:736381-736403 CACCCCCAGCGGGCCCCAGGAGG - Intronic
1160868356 19:1266047-1266069 CACACACAGCGCCACGCAGACGG + Intronic
1161052029 19:2169150-2169172 CACTCACCGCCGCCCACAGCCGG - Intronic
1161055458 19:2188636-2188658 CACACACAGTGGCTCTCACCGGG - Intronic
1161284719 19:3463344-3463366 GAGACACAGCGGACCCCGGCCGG + Intronic
1161349896 19:3785788-3785810 CACACACAGCCGCCCCACACTGG + Intronic
1161590756 19:5128154-5128176 CGCACACAGGGGACTCCAGCCGG - Intronic
1161684585 19:5696503-5696525 CACCCACAGCCACGCCCAGCAGG - Intronic
1162367228 19:10256892-10256914 CACACACAGCTGCGCACATCTGG + Intronic
1163115301 19:15185394-15185416 CACACACAGCGGAACCTGGCAGG + Exonic
1164885272 19:31773372-31773394 CACACACAGAGGCCCATAGCTGG + Intergenic
1164937912 19:32229383-32229405 CACACAGAGCAGCCCCCTCCAGG - Intergenic
1165861620 19:38912089-38912111 CGCACTCACCCGCCCCCAGCAGG + Exonic
1167717410 19:51152705-51152727 CACACACAGAGGGCCCCAGCAGG + Intronic
1167767327 19:51492173-51492195 CACACACAGGAGGCCTCAGCAGG - Intronic
925744028 2:7029717-7029739 CACACACAGCCGGAGCCAGCAGG + Intronic
928370469 2:30736707-30736729 CAGACACAGCGGGAGCCAGCTGG - Intronic
932345634 2:70993717-70993739 AATACACAGTGGCCACCAGCAGG - Exonic
932682937 2:73842238-73842260 CACAGACAGTGGCCCCAGGCAGG - Intronic
933455009 2:82508732-82508754 CAGACACAGGTGCCCACAGCAGG + Intergenic
933759946 2:85666192-85666214 CACACACACAGCACCCCAGCTGG - Intronic
933759969 2:85666379-85666401 CACACACACAGTACCCCAGCTGG - Intronic
935893732 2:107710463-107710485 CACACACACAGCCCCCCTGCAGG + Intergenic
935987471 2:108688816-108688838 CACACACAGCGGCCCCCAGCAGG + Intergenic
936126297 2:109791513-109791535 CACACACAGCGGCCCCCAGCAGG + Intergenic
936218396 2:110579955-110579977 CACACACAGCGGCCCCCAGCAGG - Intergenic
937080692 2:119137607-119137629 CACACAGGGGGACCCCCAGCAGG + Intergenic
938839336 2:135143998-135144020 CAGCCACAGAGGGCCCCAGCGGG - Intronic
941377357 2:164748011-164748033 CACACACAGCTGGTCTCAGCTGG - Intronic
942457038 2:176145366-176145388 CCCACACTGCTGCCCCCACCAGG - Intergenic
945026176 2:205621989-205622011 CACACACAGTGGCCCCGGCCAGG - Intergenic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
946076032 2:217074415-217074437 CACACACACCTGCCCCTGGCAGG + Intergenic
946603110 2:221373171-221373193 GACACAAAGCAGCCCCCAGTGGG + Intergenic
946717190 2:222565062-222565084 CACTCACAGTGGCACCCATCAGG - Intergenic
947605771 2:231484142-231484164 CACCCACAGCGCCCCCACGCTGG - Intergenic
947791234 2:232870569-232870591 CCCACACAGCTGCTGCCAGCCGG - Intronic
948130591 2:235597675-235597697 CACACAGACAGGGCCCCAGCGGG - Intronic
948181892 2:235988857-235988879 CACTCACATGGTCCCCCAGCAGG + Intronic
948197923 2:236108797-236108819 CACACACAGCGGCCCCTGTGAGG + Intronic
1168795560 20:608467-608489 CACTGACAGGGGCCCACAGCTGG + Intronic
1173226812 20:41166987-41167009 CCCACACTGTGGCTCCCAGCTGG - Intronic
1174398634 20:50263718-50263740 CACACACAGTGGCTCCATGCGGG + Intergenic
1175742271 20:61428075-61428097 CATAGACAGAGACCCCCAGCAGG + Intronic
1175832994 20:61977213-61977235 CACACACAACACCGCCCAGCGGG + Intronic
1175985004 20:62760324-62760346 CAGACAGAGCAGCCCCCACCCGG + Exonic
1176028009 20:62996044-62996066 CAGACGCAGCAGCCTCCAGCTGG - Intergenic
1176144848 20:63561006-63561028 CACACACAGGGCACCCCAGGTGG + Intronic
1176153458 20:63605634-63605656 CACCCAGAACGGCACCCAGCAGG + Intronic
1176308298 21:5135846-5135868 CACACACTGCAGCCCCAACCAGG + Intronic
1178438642 21:32581155-32581177 CAGACACAGCAGACGCCAGCAGG + Intronic
1179614148 21:42570896-42570918 CACACACACCGGACCCCCTCTGG + Intronic
1179848762 21:44126186-44126208 CACACACTGCAGCCCCAACCAGG - Intronic
1179930807 21:44569790-44569812 CACACACAGCAGCCTCCATCGGG - Intronic
1179953352 21:44724011-44724033 CACCCAGGGCGGGCCCCAGCGGG - Intergenic
1180098812 21:45574797-45574819 CCCACACAGCTGCAGCCAGCTGG - Intergenic
1180105026 21:45612887-45612909 CAGACACGCAGGCCCCCAGCTGG - Intergenic
1180105074 21:45613123-45613145 CAGACACTCAGGCCCCCAGCTGG - Intergenic
1181242245 22:21483312-21483334 CACACACCCCCGCCCACAGCAGG - Intergenic
1182308191 22:29386071-29386093 CTCAGACACAGGCCCCCAGCAGG + Intronic
1182461945 22:30489613-30489635 CTCACCCAGCTGCCTCCAGCTGG + Exonic
1182736716 22:32536101-32536123 CACTCACAGATGTCCCCAGCAGG - Intronic
1183272659 22:36871789-36871811 GGCACACAGCAGCACCCAGCAGG - Intronic
1183464240 22:37971637-37971659 CACACACAGCAGCCCACGCCAGG - Intronic
1184521098 22:44994665-44994687 CACACACAGCTGAGCCCAGCTGG + Intronic
1184857573 22:47154783-47154805 CACTCTCAGCGGCCCCCTCCTGG + Intronic
949872899 3:8604360-8604382 CACACACAGTGGCCCCAACCGGG + Intergenic
951180657 3:19654773-19654795 CCCACACAGAGTACCCCAGCTGG - Intergenic
952222747 3:31341294-31341316 CACACACTGCTGCTCCCTGCAGG - Intergenic
952931692 3:38365670-38365692 CACCCACAGCAGCCTCCAGCTGG - Exonic
952959203 3:38579286-38579308 CCCAAGCAGCGGCGCCCAGCTGG + Intronic
954299412 3:49691488-49691510 CACCCCCAGCAGCCACCAGCAGG + Exonic
958837786 3:99166580-99166602 CACACACTGGGGCCTGCAGCGGG - Intergenic
961400541 3:126638962-126638984 CACACAGAAAGGTCCCCAGCTGG + Intronic
961609801 3:128127593-128127615 CACACACAGTAGCCCTCAGGAGG - Intronic
961653686 3:128429910-128429932 CACACAGGGCCGCCACCAGCCGG + Intergenic
962654829 3:137532469-137532491 CACACAAAGCTGACCCAAGCTGG - Intergenic
962677549 3:137768111-137768133 GGCACACAGAGCCCCCCAGCTGG + Intergenic
964505665 3:157396094-157396116 CACACACTGGGGCCTGCAGCGGG - Intronic
969450058 4:7268006-7268028 CCCACACAGCCGGCACCAGCGGG - Intronic
973048937 4:45571033-45571055 CACACACAGCAGCTCCCTGGGGG + Intergenic
983730685 4:170990233-170990255 CATACACAGGGACCCCCATCAGG - Intergenic
985499192 5:230829-230851 TGCACACAGCGGCCCACATCTGG - Intronic
990722141 5:58708490-58708512 CAGACAGAGTGGCACCCAGCTGG + Intronic
994680167 5:102876728-102876750 CAAACACAGCTGGCCCCATCGGG - Intronic
997409712 5:133681720-133681742 CACACAGAGCTTCCACCAGCTGG - Intergenic
997531821 5:134586215-134586237 CACACTCAGGGGCTCTCAGCGGG - Intergenic
997638212 5:135430647-135430669 CACAGACAGTGGCCCCAGGCCGG - Intergenic
1000811583 5:165869567-165869589 CACACACACCAGCCTCCAGAAGG - Intergenic
1001210775 5:169808296-169808318 AACACACAGCGCCCCCCAAATGG - Intronic
1001400216 5:171441982-171442004 CAGACCCAGCTTCCCCCAGCAGG + Intronic
1001599744 5:172921089-172921111 CATACAAAGCAGCCCGCAGCTGG - Intronic
1002597772 5:180335329-180335351 GACACACCGTGGGCCCCAGCGGG - Intronic
1003298357 6:4854087-4854109 CACACACGGCCTCCTCCAGCAGG + Intronic
1003524320 6:6885510-6885532 CACACGCTGCGGCCCACCGCTGG - Intergenic
1005992126 6:30909978-30910000 CACACACAGCTGCTCCCAGGCGG + Exonic
1006435134 6:34022080-34022102 CACACACAGAGGCCACCAGGAGG + Exonic
1006592009 6:35165271-35165293 CAGAGACAGGGGCCCCAAGCTGG + Intergenic
1009211068 6:60863740-60863762 CAAATACTGCAGCCCCCAGCTGG - Intergenic
1011610640 6:89146710-89146732 CACACACACCTGCCCCGGGCGGG - Intronic
1014740446 6:125143127-125143149 ACCCCACAGCGGCACCCAGCTGG + Intronic
1015754094 6:136590493-136590515 CACAGACAGTGGCCCCTACCAGG - Intronic
1018892891 6:167995443-167995465 CACACAGAGGGGTCCCCAGGCGG + Intergenic
1019705680 7:2496147-2496169 CACACACAACAGCCGCCAGGCGG - Intergenic
1026828329 7:73597181-73597203 CTCACACAGCTGCTCACAGCAGG - Exonic
1028532401 7:91852023-91852045 CACACACATCAGCCCCCAGCTGG - Intronic
1034879672 7:154753560-154753582 CACACCCAGATGGCCCCAGCTGG - Intronic
1034924381 7:155109635-155109657 CACACACAGTGTGTCCCAGCTGG - Intergenic
1034995523 7:155574793-155574815 CACTCACATCAGCCCACAGCTGG - Intergenic
1035470420 7:159105666-159105688 CTCACACAGGGAGCCCCAGCAGG + Intronic
1037927074 8:22851952-22851974 CCCACACAGCTGATCCCAGCTGG - Intronic
1038055259 8:23852042-23852064 CACACACAGAGGCACTCATCTGG - Intronic
1038251384 8:25908178-25908200 CACACACAGCTGCCCACAGCAGG - Intronic
1039399869 8:37260683-37260705 AGCACACAGCAGCCCCCAGTGGG - Intergenic
1041868658 8:62607347-62607369 CACACATAGTTGGCCCCAGCAGG - Intronic
1042923360 8:73941450-73941472 CACACAAAACTGCACCCAGCTGG - Intronic
1044368320 8:91377192-91377214 CACACATACCAGCCCCCATCAGG + Intronic
1044710094 8:95048894-95048916 CACCCTCAGCCACCCCCAGCTGG + Intronic
1047405351 8:124581170-124581192 CACACACCACTGCGCCCAGCAGG - Intronic
1049573825 8:143381564-143381586 CACAGACAGGGGCCCCTGGCAGG - Exonic
1049836487 8:144738799-144738821 CACAAACAGGTGCCCCCAGGAGG - Intronic
1050437947 9:5629248-5629270 CACACTCAGCGGCCCCGGGCTGG - Exonic
1053368554 9:37541619-37541641 CAGACACAGCTGCCGCCAGCGGG + Exonic
1056642395 9:88382618-88382640 CACCCAGAGAGGCTCCCAGCAGG + Intergenic
1057643796 9:96854219-96854241 CGCACACCGCGGCCCGCACCCGG + Exonic
1060700518 9:125746665-125746687 CACTCACTGCGGCCCCGCGCCGG - Intergenic
1061893376 9:133634421-133634443 CCCACAACGCGGGCCCCAGCTGG + Intergenic
1062027532 9:134347449-134347471 CGGACACTGCGGCCCCCATCAGG - Intronic
1062341921 9:136097538-136097560 CTCACTCAGGGGTCCCCAGCAGG + Intergenic
1062433080 9:136534730-136534752 CACACACAGCGGCCCCATCGGGG - Intronic
1062479082 9:136743167-136743189 CACACACAGTGACCCCAGGCCGG - Intronic
1185549541 X:972261-972283 CACACTCAGCGTCCTCCATCAGG + Intergenic
1185784060 X:2875007-2875029 CAAACACTGGGGCCCCCATCAGG - Intronic
1187526596 X:20060356-20060378 CACCCCCAGCGGTCCTCAGCAGG + Intronic
1187803625 X:23093645-23093667 CACAGACAGGGGCACCCACCTGG + Intergenic
1189539400 X:41970768-41970790 GTCACTCAGAGGCCCCCAGCAGG + Intergenic
1190215897 X:48479142-48479164 CACACACAGGGGGCCCCGCCTGG - Intronic
1190881573 X:54495727-54495749 CATAGACAGCGCTCCCCAGCGGG - Exonic
1194410837 X:93555650-93555672 CACTCACAACGGTCCCCAGTGGG - Intergenic
1197958793 X:131981179-131981201 ATCACAGAGCAGCCCCCAGCAGG - Intergenic
1199649288 X:149937961-149937983 CACACACAGCGGCCCCATCTCGG - Intronic
1200104300 X:153703768-153703790 CACACACAGACGCCTCCAGCAGG + Intronic
1200223687 X:154404868-154404890 CACCCTGAGCAGCCCCCAGCTGG - Exonic
1200283870 X:154802347-154802369 CACACTCAGTGACCACCAGCGGG + Intronic
1201634589 Y:16108378-16108400 GAGACACAGCTGCCCACAGCTGG - Intergenic