ID: 935996382

View in Genome Browser
Species Human (GRCh38)
Location 2:108778814-108778836
Sequence GGATTGCTTTAGAGCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935996382_935996388 5 Left 935996382 2:108778814-108778836 CCTCCTGGGCTCTAAAGCAATCC 0: 1
1: 0
2: 6
3: 40
4: 157
Right 935996388 2:108778842-108778864 CCTCAGCTTCCCAAGTAGCTGGG 0: 4502
1: 102942
2: 212219
3: 251572
4: 265501
935996382_935996386 4 Left 935996382 2:108778814-108778836 CCTCCTGGGCTCTAAAGCAATCC 0: 1
1: 0
2: 6
3: 40
4: 157
Right 935996386 2:108778841-108778863 ACCTCAGCTTCCCAAGTAGCTGG 0: 889
1: 18179
2: 120127
3: 229858
4: 283878
935996382_935996389 13 Left 935996382 2:108778814-108778836 CCTCCTGGGCTCTAAAGCAATCC 0: 1
1: 0
2: 6
3: 40
4: 157
Right 935996389 2:108778850-108778872 TCCCAAGTAGCTGGGACCACAGG 0: 4135
1: 51604
2: 165139
3: 224358
4: 223435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935996382 Original CRISPR GGATTGCTTTAGAGCCCAGG AGG (reversed) Intronic
900396180 1:2454109-2454131 GGACTGCTGGAGAGGCCAGGTGG - Intronic
903791737 1:25897952-25897974 GGATTGCTCCAGAGCCCAGCAGG + Intronic
904823501 1:33259690-33259712 TGTTGGCTTTAGAGCCCTGGAGG - Intronic
905921930 1:41725399-41725421 GAATTATGTTAGAGCCCAGGAGG + Intronic
907841092 1:58158280-58158302 GGATTAGTTCAGAGCCCAGGGGG + Intronic
909406548 1:75296733-75296755 GCATTGGTTTTGAGACCAGGTGG - Intronic
911640939 1:100288477-100288499 GGATCATTTGAGAGCCCAGGAGG - Intronic
912691755 1:111809962-111809984 TGCTGCCTTTAGAGCCCAGGAGG - Intronic
913961693 1:143343538-143343560 GGATCGCTTGAGCCCCCAGGTGG - Intergenic
914056048 1:144169110-144169132 GGATCGCTTGAGCCCCCAGGTGG - Intergenic
914123098 1:144797252-144797274 GGATCGCTTGAGCCCCCAGGTGG + Intergenic
920947045 1:210539432-210539454 GGAAGGCCTTTGAGCCCAGGTGG + Intronic
923547576 1:234934054-234934076 GGATTGCTTGAGAGCCTGGGAGG - Intergenic
1065631315 10:27683869-27683891 GGATTGCTTGTGAGCCCTGGGGG - Intronic
1067204465 10:44201200-44201222 GTATTGCTTCACAGCCCTGGTGG - Intergenic
1067295564 10:44973479-44973501 GGATTGATCTAAATCCCAGGTGG + Intronic
1068517554 10:58043172-58043194 GGAATGGTTCAGAGCACAGGTGG - Intergenic
1069914446 10:71778843-71778865 GGATTGCTCTTGAGTCCAGGAGG - Intronic
1071592097 10:86884170-86884192 GGATCGCTTAAGAACCCAGCAGG - Intronic
1074093279 10:110283868-110283890 GGATCACTCTTGAGCCCAGGAGG - Intronic
1077343607 11:2036712-2036734 GGCTTCCTTTGGAGCCCAGATGG + Intergenic
1077790226 11:5431192-5431214 GGATGGCTGTATAGCGCAGGAGG + Intronic
1078107897 11:8370133-8370155 GGATTGCGGTAGAGCTAAGGGGG + Intergenic
1078574819 11:12491250-12491272 GGATTTCTTTTGAGCCTGGGAGG - Intronic
1081843027 11:46217160-46217182 AGATCGCTTGAGAGCTCAGGAGG + Intergenic
1083456496 11:62782362-62782384 GGATTGCTGCAGAGCCAAGTGGG + Intronic
1084016685 11:66387414-66387436 GGATTGCTTTTGAGCCTGGGAGG + Intergenic
1084347970 11:68569244-68569266 GTATTGCTTTAGAGCCTAAATGG - Intronic
1084538224 11:69770723-69770745 AAATTGCTTTAGAGAACAGGAGG + Intergenic
1086452524 11:86931079-86931101 GGATTGCTCTGGAGCCTATGAGG + Intronic
1087274727 11:96149642-96149664 GAATTGCTTTTGAACCCAGTAGG + Intronic
1087389155 11:97512643-97512665 GGAATGCTTTATGGCCAAGGGGG - Intergenic
1087775849 11:102256016-102256038 GGATCGCTTGAGAGCCTGGGAGG - Intergenic
1088900514 11:114112995-114113017 GAATGGCTTGAGCGCCCAGGTGG - Intronic
1202826593 11_KI270721v1_random:91901-91923 GGCTTCCTTTGGAGCCCAGATGG + Intergenic
1092773751 12:11922853-11922875 GGTGTGCTTTGGAGCTCAGGAGG - Intergenic
1096629913 12:52919734-52919756 GAATAGCTTGAGAACCCAGGAGG - Intronic
1097966453 12:65586778-65586800 GGATGGCGTGAGAGCACAGGAGG - Intergenic
1100464404 12:94832830-94832852 GGATTGCTTCTGAGCCTGGGAGG - Intergenic
1100464737 12:94834957-94834979 GGCATGCTTTGGAGCCCAGCTGG + Intergenic
1102034929 12:109765668-109765690 GGATTGGTTGTGAGCCCACGAGG + Intronic
1102638832 12:114348276-114348298 GGATCACTTGAGAGCTCAGGAGG + Intergenic
1104690200 12:130819514-130819536 GGTTTTCTTTAGAGCCCAAAAGG + Intronic
1104987890 12:132607265-132607287 GTATGGCTTTGGAACCCAGGAGG - Intronic
1106905543 13:34405487-34405509 GCATTGCTTTAGAACCCCAGGGG + Intergenic
1111504597 13:89170901-89170923 GTATTGCTTTAAAGGCCAGATGG + Intergenic
1112394561 13:99017129-99017151 GGAATGCTCTAGACCCCAGAGGG - Intronic
1114858372 14:26482785-26482807 GGATCACTCTTGAGCCCAGGTGG - Intronic
1116637650 14:47417799-47417821 GGATTGCTTGAGCTCCAAGGAGG - Intronic
1117283855 14:54266899-54266921 GAATTGCTTGAGAGCCCATGGGG + Intergenic
1119689499 14:76660335-76660357 GGATGCCTTCAGAGCCCTGGTGG + Intergenic
1120926657 14:89803853-89803875 GAATTGCTGTAGAGCCCTGCAGG - Intronic
1122386635 14:101352814-101352836 GGATGGCTCTGGAGCACAGGTGG - Intergenic
1125638749 15:41211872-41211894 GGATTGCTAGAGATCCTAGGAGG + Intronic
1125878776 15:43173945-43173967 GAATTGCTTGAGAACCCATGTGG - Intronic
1126004538 15:44243656-44243678 GGATTGCTTGAGCCCACAGGTGG + Intergenic
1128070865 15:64796034-64796056 GTCTTGCTTTGTAGCCCAGGTGG + Intergenic
1128163504 15:65440614-65440636 TGATTTCTTTAGAGCTGAGGTGG + Intergenic
1129388883 15:75210675-75210697 GGATGGCTTTGGAAGCCAGGAGG + Intronic
1129987938 15:79935236-79935258 GGCCTCCTTCAGAGCCCAGGAGG - Intergenic
1130004711 15:80083876-80083898 TGAGAGCTTTAGGGCCCAGGAGG + Intronic
1131377370 15:91936816-91936838 CCATTGCTTTAGCCCCCAGGAGG + Intronic
1135469360 16:22715528-22715550 GAATTGCTTGTGAACCCAGGAGG + Intergenic
1138901538 16:61276327-61276349 GGATTGCTTGAGCCCCCAGGAGG - Intergenic
1139789258 16:69419250-69419272 GGATTGCTTGCAAGCCCGGGAGG + Intergenic
1140259801 16:73367956-73367978 GAATTGCTTGAAAACCCAGGAGG - Intergenic
1140380274 16:74480645-74480667 GGATTGCCTTCAAGCCCCGGGGG - Intronic
1142722628 17:1786849-1786871 GGATGGCTGCAGGGCCCAGGTGG - Exonic
1142775908 17:2138810-2138832 TAATTGCTTTAGATCCCAAGAGG - Intronic
1142978844 17:3660066-3660088 GGATTGGCTTGGATCCCAGGTGG - Intronic
1143581289 17:7828478-7828500 GTCTTGCTCTATAGCCCAGGTGG + Intronic
1144748678 17:17633468-17633490 GGATGTCTTTACAGCCTAGGAGG + Intergenic
1147699009 17:42380122-42380144 GAATTGCTTTTGAACCCAGGAGG - Intronic
1148010974 17:44480995-44481017 GGATTGCTTAAGCCCCAAGGAGG - Intronic
1148934862 17:51156911-51156933 GAATTGCTTTTGAACCCAGGAGG + Intronic
1149604104 17:57912930-57912952 GGATCGCTTTTGAGCCCAGGAGG - Intronic
1150077758 17:62207617-62207639 GGATTGCTTGAGATCCAGGGTGG + Intergenic
1150473956 17:65460262-65460284 GGAAAGCTCTGGAGCCCAGGTGG + Intergenic
1151204733 17:72497935-72497957 GGATAGCTTGAGAGACCACGTGG + Intergenic
1151602626 17:75115632-75115654 GGATTGCTTGAGCCCCCAGGAGG + Intronic
1153741259 18:8131048-8131070 GGATTGTTTTATGGCCCATGAGG + Intronic
1154308362 18:13247107-13247129 GGCTTGCTTTAGGTGCCAGGAGG + Intronic
1158988506 18:62844247-62844269 GAATCGCTTTTGAACCCAGGAGG + Intronic
1163122194 19:15224624-15224646 GGCTTGCTCTATTGCCCAGGCGG - Intergenic
1163257031 19:16162334-16162356 GGATTGCTCTTGAGCCCAGGAGG + Intronic
1163331912 19:16644524-16644546 GAATTGCTTAAAAACCCAGGAGG - Intronic
1163808042 19:19412042-19412064 GGATTGCTACATTGCCCAGGCGG - Intronic
1164252308 19:23489534-23489556 GTCTTGCTGTATAGCCCAGGCGG - Intergenic
1164937787 19:32228587-32228609 GGATGACATTAGAACCCAGGAGG - Intergenic
1165271198 19:34709242-34709264 GGATTGCTTGAGAGCCTGGGAGG - Intergenic
1166822701 19:45590448-45590470 AGATCGCTGGAGAGCCCAGGAGG + Exonic
926723284 2:15978715-15978737 GGATTTATTTTGAGCCCAGATGG + Intergenic
926831473 2:16967047-16967069 GCATTGATTTAGTTCCCAGGAGG + Intergenic
928021613 2:27709496-27709518 GAATTGCTTGATTGCCCAGGAGG - Intronic
930192093 2:48470428-48470450 GAATTGCTTGAGAACCCGGGAGG + Intronic
932171827 2:69564631-69564653 GTATTCCTTTAGAGCCCAACAGG + Intronic
933921129 2:87047552-87047574 GGCTTGGTTTATAGGCCAGGTGG - Intergenic
933930506 2:87146243-87146265 GGCTTGGTTTATAGGCCAGGTGG + Intergenic
934001837 2:87722033-87722055 GGCTTGGTTTATAGGCCAGGTGG + Intergenic
934276696 2:91578836-91578858 GGATCGCTTGAGCCCCCAGGTGG - Intergenic
935957227 2:108389493-108389515 GGATTGCCCTTGAGCCCAGCAGG - Intergenic
935996382 2:108778814-108778836 GGATTGCTTTAGAGCCCAGGAGG - Intronic
938032017 2:128003037-128003059 GGATCGCTTGAGAGCCCAGGAGG + Intronic
941929601 2:170926769-170926791 GGGATGATTTTGAGCCCAGGAGG + Intergenic
942039028 2:172039755-172039777 GAATTGCTTTAGAACCCGGGAGG - Intronic
942745758 2:179230221-179230243 AGATCACTTGAGAGCCCAGGAGG - Intronic
943595109 2:189846422-189846444 GAATTGCTTTTGAACCCAGGAGG + Intronic
948380983 2:237549930-237549952 GGATTGCTTGTGAGCAGAGGAGG - Intronic
948426841 2:237893848-237893870 GAATTGCTCTCGAACCCAGGAGG + Intronic
1170851038 20:20004797-20004819 GGATTGTGCTTGAGCCCAGGAGG - Intergenic
1171787547 20:29482817-29482839 TGATTGCTTTATAGCCTAGCAGG - Intergenic
1172697694 20:36833761-36833783 GGATCCCTTGAGAGCCCAGGAGG + Intronic
1173814584 20:45977154-45977176 GAATTGCTTGAAAACCCAGGAGG + Intergenic
1173860207 20:46278152-46278174 GGAGTGCCTAGGAGCCCAGGGGG - Intronic
1177063854 21:16404983-16405005 GAATTTCTTTAGTGCCAAGGGGG + Intergenic
1179605436 21:42513104-42513126 GGATGGCTTCAGAGCAGAGGGGG - Intronic
1180028542 21:45184536-45184558 GGATCGCTTAAGAGCCCAGGAGG - Exonic
1180761778 22:18215956-18215978 GAATTGCTTAGGAGCCCAGGAGG - Intergenic
1180773889 22:18408654-18408676 GAATTGCTTAGGAGCCCAGGAGG + Intergenic
1180805239 22:18658198-18658220 GAATTGCTTAGGAGCCCAGGAGG + Intergenic
1180805505 22:18711210-18711232 GAATTGCTTAGGAGCCCAGGAGG - Intergenic
1181069948 22:20327368-20327390 GAATTGCTTAGGAGCCCAGGAGG + Intergenic
1181192991 22:21155579-21155601 GAATTGCTTAGGAGCCCAGGAGG + Intergenic
1181216451 22:21336995-21337017 GAATTGCTTAGGAGCCCAGGAGG - Intergenic
1182691460 22:32166556-32166578 GGATCCTTTGAGAGCCCAGGTGG + Intergenic
1203235721 22_KI270731v1_random:149628-149650 GAATTGCTTAGGAGCCCAGGAGG + Intergenic
949116024 3:324726-324748 GGATTAATTTTGAGACCAGGAGG - Intronic
951318653 3:21218111-21218133 GGATGGCTTTAGAGGACAAGAGG + Intergenic
951850121 3:27129965-27129987 GGATTTCTTTAGCACCCAGGAGG + Intronic
952180729 3:30913925-30913947 GGATTGCTTGAGAGCCCGGGAGG - Intergenic
952426608 3:33181471-33181493 GGATTGCTTGAGAGTCCAAGAGG - Intronic
953490545 3:43346651-43346673 GGGTTGCTTGATATCCCAGGGGG + Intronic
955000192 3:54920431-54920453 GGATTGCTAGAGAAGCCAGGAGG - Intronic
962327515 3:134447992-134448014 GCCTTGCTTCAGAGCCCATGTGG + Intergenic
962790594 3:138807803-138807825 GGATCGCTTTTGAGCTCGGGAGG + Intronic
963851413 3:150214322-150214344 GAATTGCTTAAGAGTCCAGGAGG - Intergenic
966809074 3:183827532-183827554 GGGTTGCTTTGGAGACCAGCTGG + Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967969852 3:194990977-194990999 GGATTGCTCTAGAGCACAGCAGG - Intergenic
969034070 4:4237552-4237574 GGATTGCTTGAGCCCCCAAGTGG + Intronic
970206341 4:13659228-13659250 GAATTACATTAAAGCCCAGGCGG - Intergenic
972622452 4:40760771-40760793 GAATTGCTTGAAAACCCAGGAGG + Intronic
976335597 4:83881928-83881950 GGACTGCTTGAGACCCCAGGAGG + Intergenic
978489319 4:109294840-109294862 GGACTGCTTTGCAGCCCTGGGGG - Intronic
978758202 4:112326801-112326823 GGATTCATTTAGAGCCCATAGGG + Intronic
979063944 4:116102552-116102574 GAATCGCTTGAGAACCCAGGAGG + Intergenic
981103758 4:140857718-140857740 GAATTGCTTTCGAACCCAGGAGG + Intergenic
981260239 4:142709901-142709923 GCATAGATTTACAGCCCAGGAGG + Intronic
984997475 4:185449431-185449453 GGATTGCCTAAAAGCCTAGGAGG + Intronic
986634799 5:9810766-9810788 GCATTGCTTGAGGGCCCAGGAGG + Intergenic
988576140 5:32426813-32426835 GAATTGCTTGAAAACCCAGGGGG + Intronic
990640317 5:57776209-57776231 GGCTTACTTTATAGCCCATGAGG - Intergenic
991631530 5:68661028-68661050 GGATTGCTATAGAGCCATGTAGG - Intergenic
992985557 5:82225394-82225416 GGGTTAATTTAGAACCCAGGAGG - Intronic
993482394 5:88439776-88439798 TGATTGCTTTAGAGCGCACAGGG - Intergenic
994332079 5:98518254-98518276 GTGTTGCTTTAAAGCCCAGTTGG - Intergenic
995277583 5:110294585-110294607 AGATAGCTTGAGAACCCAGGCGG + Intronic
996433855 5:123412420-123412442 GGATAGCTTTAAAGCAAAGGGGG - Exonic
997228396 5:132226693-132226715 GTATTGCTGGACAGCCCAGGTGG - Exonic
997823136 5:137083872-137083894 GTCTTGCTCCAGAGCCCAGGAGG - Intronic
1002384620 5:178857137-178857159 GTCTTGCTTTATTGCCCAGGCGG + Intergenic
1002625519 5:180525447-180525469 GGATGGCTTTTGAGCCTGGGAGG + Intronic
1006233993 6:32611579-32611601 AGAATCATTTAGAGCCCAGGAGG - Intergenic
1007245068 6:40455561-40455583 GGCTTGTTTGAGAGCCCTGGGGG - Intronic
1007540106 6:42634481-42634503 GGTTTGCTCTATCGCCCAGGCGG + Intronic
1008216201 6:48792876-48792898 GAATCGCTTGAGAGCCCAGGAGG - Intergenic
1009023903 6:57974776-57974798 GTATTGCCTGAGAGCACAGGAGG + Intergenic
1012647225 6:101700839-101700861 GGACTGGTATAGAGCCCAGGGGG + Intronic
1014828858 6:126077902-126077924 GCATTTCTTTAAAGCCCAGAAGG - Intergenic
1022898251 7:34774613-34774635 GCATTGCTTCAGAGCCCTAGGGG + Intronic
1024037951 7:45524422-45524444 TGATTGCTTTATCTCCCAGGTGG + Intergenic
1029746761 7:102519763-102519785 GAATTGCTTGAGAACCCGGGAGG + Intergenic
1029764700 7:102618740-102618762 GAATTGCTTGAGAACCCGGGAGG + Intronic
1033757847 7:144410143-144410165 GGATGGCTTCAAAGCCCAGGAGG - Exonic
1034761526 7:153676867-153676889 GGATGGCTTAAGAGCCCATTAGG + Intergenic
1035186877 7:157133332-157133354 GGATTGTTTGAGCGCCCAGGAGG - Intergenic
1035241638 7:157534344-157534366 GGATCCCTTTAGACCCCAGTAGG - Intergenic
1037451851 8:19023516-19023538 GGATTGCTTGAGTCCACAGGAGG - Intronic
1039927223 8:41946187-41946209 GGATCACTTGAGTGCCCAGGAGG - Intronic
1040850124 8:51891814-51891836 TGATTCCTTTAGATCCAAGGGGG - Intronic
1041071729 8:54131909-54131931 GAATTGCTTGAAATCCCAGGAGG - Intergenic
1043430860 8:80193870-80193892 GGATCACTTTTGAGCCCAGGAGG - Intronic
1043722651 8:83565240-83565262 GAATTGCTGTTCAGCCCAGGGGG + Intergenic
1043952925 8:86329377-86329399 GGATTCCTTGAGAGCCCAGGAGG + Intergenic
1045307028 8:100966805-100966827 GGATCGCTTGAGAGCCTAGGAGG - Intergenic
1045524769 8:102932285-102932307 ACATGGCTCTAGAGCCCAGGAGG - Intronic
1046328038 8:112675470-112675492 AGATTGCTTTAGATCAAAGGGGG + Intronic
1047444472 8:124907014-124907036 GTATTGCCTGAGAGCACAGGGGG - Intergenic
1048045017 8:130765047-130765069 TGATTGCTTTAGAGCCCACCAGG - Intergenic
1049967936 9:796134-796156 TGATTGCTTTAAAGCCCCTGAGG + Intergenic
1050075393 9:1857596-1857618 GGATTGACTTAGAGCCAAGAGGG + Intergenic
1052933406 9:34074135-34074157 GGATTGCTTGAGTGACCAGGAGG + Intergenic
1056098008 9:83273903-83273925 GGATCACTTTGAAGCCCAGGAGG - Intronic
1057842175 9:98495106-98495128 GGCCTGCTTGACAGCCCAGGTGG - Intronic
1059043367 9:110838880-110838902 GGATAGCTTAAAAGCCCAGGAGG + Intergenic
1059392531 9:114008212-114008234 GGTTTGCCTTGGGGCCCAGGAGG - Intronic
1059714636 9:116902541-116902563 GTATAGGTTTATAGCCCAGGAGG + Intronic
1203790306 EBV:147980-148002 GGAATGCTTTGGAGCCGAGAGGG + Intergenic
1194819592 X:98489528-98489550 GTATTGGTTTAGTGGCCAGGAGG - Intergenic
1195050179 X:101089663-101089685 GAATTGCTTTTGAGCCCCAGAGG + Intronic
1198257767 X:134939931-134939953 GGATTGCTTGAAAACCCAGGAGG - Intergenic
1200822936 Y:7606456-7606478 TGAGTGTTTTAGAGCCCATGGGG + Intergenic
1201341782 Y:12942230-12942252 GGATTTCTTGAAAGCCCATGTGG - Intergenic
1202237119 Y:22724639-22724661 TGAGTGTTTTAGAGCCCATGGGG - Intergenic