ID: 935996407

View in Genome Browser
Species Human (GRCh38)
Location 2:108778971-108778993
Sequence CTGTGCAAGGCCAAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31782
Summary {0: 1, 1: 2, 2: 62, 3: 1759, 4: 29958}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935996407_935996414 11 Left 935996407 2:108778971-108778993 CCTGCCACCTTGGCCTTGCACAG 0: 1
1: 2
2: 62
3: 1759
4: 29958
Right 935996414 2:108779005-108779027 TAGGCATGAGCCACTGCACCTGG 0: 816
1: 9554
2: 33163
3: 80351
4: 135947
935996407_935996413 -8 Left 935996407 2:108778971-108778993 CCTGCCACCTTGGCCTTGCACAG 0: 1
1: 2
2: 62
3: 1759
4: 29958
Right 935996413 2:108778986-108779008 TTGCACAGTGCTGGGATTGTAGG 0: 1
1: 1
2: 103
3: 3322
4: 55322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935996407 Original CRISPR CTGTGCAAGGCCAAGGTGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr