ID: 936000599

View in Genome Browser
Species Human (GRCh38)
Location 2:108825153-108825175
Sequence GTAAATAATAGGGAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936000593_936000599 3 Left 936000593 2:108825127-108825149 CCTAGACTCTTCAACAAGTTAAT 0: 1
1: 0
2: 1
3: 25
4: 298
Right 936000599 2:108825153-108825175 GTAAATAATAGGGAGGTGGGAGG 0: 1
1: 0
2: 0
3: 27
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936000599 Original CRISPR GTAAATAATAGGGAGGTGGG AGG Intronic
900658011 1:3769694-3769716 ATAAAAAATAAGGTGGTGGGGGG + Intronic
901043000 1:6376880-6376902 ATAAATAATAATAAGGTGGGAGG + Intronic
901209156 1:7514833-7514855 GCGAATAATGGGGTGGTGGGGGG - Intronic
902728434 1:18352590-18352612 GTAAAGAAAGGGGTGGTGGGCGG - Intronic
906219957 1:44070700-44070722 ATAAAGACAAGGGAGGTGGGAGG - Intergenic
907251046 1:53139717-53139739 TTAGATAATATGGAGGTGGGTGG - Intronic
908518945 1:64922183-64922205 GTAACTAACTGGGGGGTGGGGGG - Intronic
909815351 1:79985332-79985354 GTAAATAAGGGGGAAGGGGGAGG + Intergenic
911196105 1:94997070-94997092 GACATTAATAGGGAGGTGGCGGG + Intronic
911519437 1:98910788-98910810 GTACATCTTAGGGAGGTGGGAGG + Intronic
911658296 1:100469828-100469850 GAGTATAATAGGGAGGTTGGAGG - Intronic
911769537 1:101722816-101722838 GTAAAGAATAGGGGGTTGTGGGG + Intergenic
911878855 1:103207312-103207334 GTAAAAATTAAGGATGTGGGAGG + Intergenic
911891041 1:103372184-103372206 TTAAATAAGAGGGAGGAAGGAGG - Intergenic
912997559 1:114546424-114546446 ATAAATAATAGGTAGGTGATAGG + Intergenic
914254720 1:145952378-145952400 CTAAAGAACAGTGAGGTGGGAGG + Intronic
914698313 1:150106647-150106669 GAAAATAATGGGGTGATGGGGGG - Intronic
915936118 1:160091272-160091294 GTGCATAGTAGGGAGGTGGTTGG - Intergenic
917021449 1:170592947-170592969 GAAAATAAAAGGGAGGCTGGAGG + Intergenic
917217813 1:172696321-172696343 CTAAAGAATAGGGTGGTTGGAGG + Intergenic
917750319 1:178047357-178047379 GTAAATGGTAGGAAGGTGTGAGG + Intergenic
918648665 1:186931912-186931934 GTAAAAGAGAGGAAGGTGGGTGG - Intronic
919310592 1:195901864-195901886 ATAATTAATAGGAAGGTGGCAGG + Intergenic
919745020 1:201003466-201003488 GATGGTAATAGGGAGGTGGGAGG + Intronic
919810905 1:201408303-201408325 GGAAACAATTGGGAGGAGGGTGG + Exonic
920574993 1:207053023-207053045 GTAACTAATAGGGCTGGGGGCGG - Intronic
920746756 1:208636067-208636089 GTAAATAAAACGGAGGCAGGAGG - Intergenic
921051394 1:211514410-211514432 CTAACAAAAAGGGAGGTGGGGGG - Intergenic
1062776070 10:149066-149088 GTAAATAATAGGGAGGGAAGAGG + Intronic
1062778627 10:179280-179302 GAAAATTATTGGGAGGTGGGAGG + Intronic
1062970642 10:1645700-1645722 GTAGATGGCAGGGAGGTGGGAGG - Intronic
1063170809 10:3508448-3508470 TTATGTAAGAGGGAGGTGGGAGG + Intergenic
1063336404 10:5219310-5219332 GTAATGGTTAGGGAGGTGGGAGG + Intergenic
1063587834 10:7368608-7368630 GTGATTAAAAGGGAGGTGGAAGG + Intronic
1064389512 10:14929487-14929509 GTAAAAATTAGCCAGGTGGGTGG + Intronic
1065741246 10:28799063-28799085 TGTAATCATAGGGAGGTGGGAGG + Intergenic
1066031199 10:31427484-31427506 AGAAATACAAGGGAGGTGGGGGG - Intronic
1066571841 10:36782087-36782109 ATAAATAAAATGGACGTGGGAGG - Intergenic
1066681634 10:37940914-37940936 GTAAATATCAGGAAGGTTGGTGG + Intergenic
1067201041 10:44172380-44172402 GTAAGTAATAGGGATTTGTGAGG + Intergenic
1068939327 10:62665261-62665283 ATAGGAAATAGGGAGGTGGGAGG - Intronic
1069718342 10:70534698-70534720 GCAAGTAAGAGGGAGGTGGGGGG - Intronic
1071036383 10:81251591-81251613 GGACGTAATAGGGAGTTGGGGGG + Intergenic
1073565909 10:104535537-104535559 GTAACTTATAGAGAGATGGGAGG - Intergenic
1073612822 10:104961057-104961079 GTAGATAATAGGCATGTTGGTGG + Intronic
1073930083 10:108566007-108566029 CTAGAAAATAGGGAGGGGGGCGG + Intergenic
1074716887 10:116228155-116228177 GGAGATAATGGGGTGGTGGGAGG - Intronic
1075541294 10:123316708-123316730 GTATGTAATAGGGTGGCGGGTGG + Intergenic
1079091792 11:17485858-17485880 GAAAATAATGGGGTGGAGGGAGG + Intergenic
1079956266 11:26869261-26869283 GTTAGTAATATGGAGATGGGAGG - Intergenic
1080758636 11:35226471-35226493 GTAAATAATAACGAGGTAGGTGG + Intronic
1081706642 11:45185906-45185928 CTTAATAAGAGGGAGGTGGGAGG + Intronic
1084164002 11:67366748-67366770 GGAAAGAAAAGGGAGGAGGGTGG - Intronic
1087264773 11:96048023-96048045 GTAGAAAATATGGAGGTGGTAGG + Intronic
1087640160 11:100747975-100747997 GAAAAAAAAAGGGGGGTGGGGGG - Intronic
1088018516 11:105090047-105090069 GTCAATAAGAGGGAGGACGGAGG + Intronic
1088764496 11:112962583-112962605 GTGAACAATAGGGAGCTGGGAGG + Intronic
1089157346 11:116412698-116412720 GTAAACAAGACGGTGGTGGGAGG - Intergenic
1089972555 11:122705743-122705765 GTAGTTAATAGGGAGGCTGGGGG + Intronic
1090572325 11:128060910-128060932 GTAAGTGATAGGGAGGAGTGTGG - Intergenic
1090988337 11:131793698-131793720 GAAAATAATAGGGTGGGAGGTGG - Intronic
1091446404 12:546254-546276 GTAAGGAGTGGGGAGGTGGGAGG + Intronic
1091527917 12:1323973-1323995 GCTAATAACAGGGAGGTGGGAGG - Intronic
1092017811 12:5173820-5173842 GTAAATATTTGGGAAGTGAGTGG + Intergenic
1092159462 12:6308172-6308194 GTAAAGAATTGGGAGGCTGGAGG - Intergenic
1094011154 12:25811250-25811272 TTAAAAAAAAGGGGGGTGGGGGG - Intergenic
1094071404 12:26418167-26418189 CTAGATAATAGGGAGGCAGGAGG + Intronic
1094098781 12:26738326-26738348 TTAAAGAATTGGGATGTGGGAGG + Intronic
1095827922 12:46549503-46549525 GAAAAAAAAAAGGAGGTGGGGGG + Intergenic
1095862694 12:46936173-46936195 TTAAATAAGAGGAATGTGGGGGG - Intergenic
1097222602 12:57459910-57459932 GGAAATAGAAGGGAGGTGAGGGG + Intergenic
1097745572 12:63298798-63298820 GTAAATGGCAGGGAGGAGGGAGG + Intergenic
1097817522 12:64091118-64091140 GTAAATAAATGGGAAATGGGAGG + Intronic
1098600850 12:72330288-72330310 TTTAAGAATTGGGAGGTGGGGGG - Intronic
1098641735 12:72846853-72846875 GTACATACTAGGGAAGTGGAAGG + Intergenic
1099550189 12:84033668-84033690 GTAAATACTAGAGAGGAGGGAGG + Intergenic
1101183572 12:102249032-102249054 AAAAAAAATAGGGTGGTGGGGGG - Intergenic
1102595637 12:113990713-113990735 GCACATAAGAGAGAGGTGGGAGG - Intergenic
1104289201 12:127453529-127453551 GTATAGAATGGGGAGGTGTGAGG + Intergenic
1104414854 12:128589515-128589537 GTAACTTATAAGGGGGTGGGGGG - Intronic
1106932060 13:34677092-34677114 GTAATTAATAAGGAGGAGGGAGG - Intergenic
1108086036 13:46794842-46794864 AAAAAGAAAAGGGAGGTGGGAGG - Intronic
1108436274 13:50404597-50404619 GAAAAAAACAGAGAGGTGGGGGG + Intronic
1108587613 13:51884192-51884214 GGAAATGTTAGGGATGTGGGAGG - Intergenic
1110648731 13:77918852-77918874 GTAAATAATATGCAGTGGGGCGG + Intronic
1112335885 13:98515506-98515528 ATAAATATTGGGGGGGTGGGGGG + Intronic
1113017103 13:105840224-105840246 AAATATAATAGGGAGGTGTGAGG + Intergenic
1113242614 13:108355172-108355194 GTAAGGAATAAGGAGGTGAGAGG + Intergenic
1113316331 13:109183362-109183384 GAAAGTCACAGGGAGGTGGGAGG + Intronic
1114615202 14:24064592-24064614 GTGGATGAGAGGGAGGTGGGGGG + Intronic
1114738761 14:25071479-25071501 GTAAAAAAAATGGAGGTAGGCGG + Intergenic
1115427420 14:33276434-33276456 GTTCATAATAGGGAGATGGGAGG - Intronic
1117819420 14:59632317-59632339 GAAAAAAATTGGGAGGAGGGAGG - Intronic
1118175384 14:63434730-63434752 TGAAAGAATGGGGAGGTGGGAGG - Intronic
1118361623 14:65062081-65062103 GTACATGATAGGGAGGAGTGAGG - Exonic
1119204146 14:72781699-72781721 GTAAATAATGGTGGGGTGGCGGG + Intronic
1119526845 14:75329563-75329585 GTAGATAGTAGAGAGGTGGGAGG + Intergenic
1119964027 14:78893094-78893116 GCAAAGAAAAGGAAGGTGGGTGG - Intronic
1124255402 15:28137687-28137709 GGACATAATAGGGAGGTCTGAGG - Intronic
1124367885 15:29086918-29086940 GGAAGAAATTGGGAGGTGGGGGG - Intronic
1124568908 15:30841935-30841957 GTACACAATAGGGAGGTCTGAGG + Intergenic
1125003123 15:34792325-34792347 GTCAATTATAGGGAGGTAGGCGG + Intronic
1127496038 15:59513127-59513149 GTAATTAAGAGGGAGGTAGCAGG + Intronic
1129987923 15:79935107-79935129 GAGAAAAATAGGGAGGGGGGTGG + Intergenic
1131015171 15:89051891-89051913 GTACATATAGGGGAGGTGGGAGG + Intergenic
1131971624 15:97899357-97899379 TTAAATAAGGGGGTGGTGGGCGG - Intergenic
1132325306 15:100963981-100964003 GTTAATAAGAGGGAGATGGATGG - Intronic
1132571099 16:644417-644439 GTAAAAAACAGCGAGGTGGGTGG - Intronic
1133469329 16:6058777-6058799 GTAAATAATTAGTTGGTGGGTGG - Intronic
1133473631 16:6098874-6098896 GTAAATAATTGGGAGGGATGTGG + Intronic
1133490383 16:6262377-6262399 GTAGATATTATGGCGGTGGGGGG + Intronic
1135759637 16:25126653-25126675 GTAAAGAATCTGGAGGTGAGAGG + Intronic
1135905960 16:26511872-26511894 GTAAAGAACATGGGGGTGGGAGG - Intergenic
1136087936 16:27898951-27898973 GCAAACAATAGGGAGGGGTGAGG - Intronic
1136268007 16:29132113-29132135 GTAAGTCAGAGGGAGGAGGGAGG + Intergenic
1140766557 16:78164860-78164882 GTAAAGCAGAGGAAGGTGGGGGG + Intronic
1140969015 16:79994954-79994976 GTAAATAATAGATAGTTGGAGGG + Intergenic
1142071313 16:88092451-88092473 GTAAATCAGAGGGAAGAGGGAGG + Intronic
1142127737 16:88418552-88418574 GAAAATGACAGGGAGGTGGCCGG - Intergenic
1143067542 17:4262243-4262265 AGTAATACTAGGGAGGTGGGAGG - Intronic
1147758878 17:42784917-42784939 GTAAATACTTGGGGGGGGGGCGG + Intronic
1149423495 17:56532914-56532936 TTACATAATGGGGAGGTGAGTGG - Intergenic
1151029308 17:70717724-70717746 GAAAACAAGAGGGAGGTCGGGGG + Intergenic
1151263707 17:72937266-72937288 GTAGATACCAGGGAGGGGGGTGG - Intronic
1152174622 17:78779632-78779654 CTTAATAAGAGGGAGGTAGGAGG + Intronic
1153593089 18:6695390-6695412 TAAAATAATATGGAGGTGGAGGG - Intergenic
1153753748 18:8259940-8259962 GTAAATAAGAGGGAGATCTGGGG - Intronic
1154329997 18:13421700-13421722 GGAAACAACAGGGCGGTGGGTGG - Intronic
1155038365 18:22044311-22044333 GTAGCAAATTGGGAGGTGGGGGG - Intergenic
1156844237 18:41645430-41645452 CTATATAATTGGGAGGTGGTTGG + Intergenic
1157250379 18:46090069-46090091 GAAAATAGTCGGGGGGTGGGGGG + Intronic
1157617780 18:48997497-48997519 GTAAATAATTGGGAACTGGCAGG - Intergenic
1157941568 18:51934438-51934460 ATGGATAAGAGGGAGGTGGGAGG + Intergenic
1158723028 18:59942719-59942741 GTAAAAAATATGGAGGTAGAGGG + Intergenic
1159248781 18:65846304-65846326 GTAAAAAATATGGTGCTGGGTGG - Intronic
1159362807 18:67427198-67427220 ATACATAATGGGGAGGTAGGTGG - Intergenic
1160145648 18:76361937-76361959 GTAAATAAGAGAGAGGAAGGAGG - Exonic
1161848757 19:6727780-6727802 CTTTATAAGAGGGAGGTGGGAGG - Intronic
1162567812 19:11453945-11453967 GAAAAAAAAAGGGGGGTGGGAGG - Exonic
1164184123 19:22846895-22846917 GTAAATTATAGGCTGGTTGGGGG - Intergenic
1164206727 19:23065207-23065229 TTATATGATAGGTAGGTGGGTGG + Intergenic
1165083822 19:33328815-33328837 GAAAGAAATAGGGAGATGGGTGG - Intergenic
1167926990 19:52829360-52829382 GAAAAAAATAGGGGGGAGGGGGG - Intronic
1168523869 19:57073504-57073526 GGAAGTAATAGGGAGGGGTGGGG - Intergenic
1168711659 19:58504350-58504372 GAAAAAAATAGGGAAGTGGCTGG + Intronic
925535801 2:4915066-4915088 GCAAAAAATAGTGTGGTGGGAGG + Intergenic
925908731 2:8557243-8557265 GGAAAAAAAAGGGGGGTGGGCGG + Intergenic
926471299 2:13261317-13261339 GAAAATAATAAAGATGTGGGAGG - Intergenic
927079579 2:19614057-19614079 CTAAGTAGCAGGGAGGTGGGTGG - Intergenic
927871710 2:26628284-26628306 CTAAAGGATTGGGAGGTGGGGGG + Intronic
928145431 2:28770372-28770394 GTAAAAAAAAGGGGGGGGGGAGG + Intronic
928501715 2:31903409-31903431 GAAAAAAACAGGGGGGTGGGGGG + Intronic
928985861 2:37181049-37181071 GTAAATAACATGAAAGTGGGAGG + Intronic
929013396 2:37470435-37470457 GTAAATAAAAGAGAAGTGGTTGG - Intergenic
930102874 2:47616633-47616655 GTAAAAGAGAGGGTGGTGGGTGG + Intergenic
933728995 2:85443230-85443252 GTAAGTACGAGGTAGGTGGGTGG - Intergenic
934501565 2:94863870-94863892 GTAAGTACTAGGGAGCTGGGGGG + Intergenic
935033550 2:99345645-99345667 GTAGAACATAGGTAGGTGGGCGG + Intronic
936000599 2:108825153-108825175 GTAAATAATAGGGAGGTGGGAGG + Intronic
936923988 2:117718151-117718173 GTAAGTAAGAGGGAGGGAGGTGG + Intergenic
937397219 2:121547386-121547408 GTGAAGAGTAGGGGGGTGGGTGG - Intronic
939542907 2:143515190-143515212 GTAAAGAAAAGGGAGGGTGGGGG - Intronic
939624647 2:144461971-144461993 GGTAAAAATGGGGAGGTGGGTGG - Intronic
940562423 2:155315937-155315959 GTTACAAATAGGGAGGTGGCCGG + Intergenic
942044920 2:172094763-172094785 GTGAATGTTTGGGAGGTGGGGGG - Intergenic
942806001 2:179931474-179931496 GAAAATAATGGGGAGATGGAAGG + Intergenic
943033914 2:182716626-182716648 GTGAATAACAGGGAGGAGGAAGG - Intronic
944900496 2:204208973-204208995 GTAAATAATAATGAAGTGAGGGG - Intergenic
945999701 2:216471114-216471136 CTAAATAATTGGGGGGTGGGAGG + Intronic
946704742 2:222447254-222447276 GTGAGAAGTAGGGAGGTGGGTGG - Intronic
948101442 2:235377211-235377233 CAAAATAATATGGAAGTGGGAGG + Intergenic
1168939374 20:1695647-1695669 TGAAAGAAGAGGGAGGTGGGAGG - Intergenic
1171033072 20:21694182-21694204 GCAACGAATATGGAGGTGGGAGG - Intergenic
1172585315 20:36079214-36079236 AAAAAAAAAAGGGAGGTGGGGGG + Intergenic
1172939114 20:38642629-38642651 ATAAATGGAAGGGAGGTGGGAGG - Intronic
1173456084 20:43202707-43202729 GTAAATATTTGGGAGGTGATGGG + Intergenic
1174464907 20:50709915-50709937 ATAAATAATAGGCCGGGGGGTGG + Intergenic
1175249037 20:57597893-57597915 GTTAAAGATAGTGAGGTGGGGGG + Intergenic
1177095297 21:16824625-16824647 GTAAAGAGTAGGGGTGTGGGAGG + Intergenic
1178674475 21:34619259-34619281 GGAAATGATTGGGAGGTGGTAGG - Intergenic
1181959437 22:26612329-26612351 GTAAAGAATTGGGGGATGGGAGG - Intronic
1182183397 22:28375543-28375565 GTAAATAATTAGGAGAGGGGAGG + Intronic
1182944505 22:34309064-34309086 GTAATTCATAGGGAGGTGGTAGG + Intergenic
1183913499 22:41097352-41097374 ATGGATAATAGGGAGGAGGGAGG + Intronic
949559111 3:5186803-5186825 GTAAATAATTTGGTGGTGGTGGG + Intergenic
950563838 3:13752592-13752614 CTAAATACTGGGGAGGGGGGAGG - Intergenic
950630608 3:14279419-14279441 GTAAGTAGTGGGGAGGTGGAAGG + Intergenic
950889337 3:16389101-16389123 GTAAATCAGAGGATGGTGGGGGG - Intronic
951310487 3:21119551-21119573 ATAGATAATAGGTAGGTTGGTGG - Intergenic
953588115 3:44223422-44223444 CTGAATCATAGGGCGGTGGGTGG + Intergenic
954665716 3:52250561-52250583 TTTAATAATAGGGAGGTGACAGG - Exonic
955167857 3:56532428-56532450 GAAAAGAATCTGGAGGTGGGGGG + Intergenic
955527598 3:59837473-59837495 GGAAATATTTGGGGGGTGGGGGG - Intronic
956635710 3:71362459-71362481 GTAAATAATAGGGCTGGGCGCGG - Intronic
957272786 3:78053134-78053156 GAAAAAAATGGGGTGGTGGGCGG + Intergenic
958256184 3:91328090-91328112 ATAAATAGTGGGGGGGTGGGTGG - Intergenic
960273451 3:115699555-115699577 GTAAATAAAAAGGAAATGGGAGG - Intronic
960413599 3:117358339-117358361 TTAAATAATAGGGAGATAAGTGG - Intergenic
963066523 3:141268835-141268857 GGAAAGAATGGGGAGGTGGCTGG + Intronic
963102268 3:141619009-141619031 ACAAATAATTGGGGGGTGGGAGG - Intergenic
964131956 3:153299251-153299273 GTAAATAAGTGTGCGGTGGGGGG + Intergenic
967456481 3:189692443-189692465 GTAAATAAAAGTGGGGAGGGAGG - Intronic
967597947 3:191349967-191349989 GAAAAAAAAAGGGAGGGGGGGGG - Intronic
969454890 4:7295146-7295168 GAAAATAAAAGGGAGGAGGAGGG - Intronic
969942012 4:10742101-10742123 GTGAAGAGTAGAGAGGTGGGAGG - Intergenic
970685138 4:18559099-18559121 GTTAAAAATAGGCAGGTGGCTGG + Intergenic
971711694 4:30121189-30121211 GTAAAGAATATGGAGCTGGGTGG + Intergenic
972571339 4:40312914-40312936 GTAGATAAGGAGGAGGTGGGGGG + Intergenic
972625114 4:40789557-40789579 CAAAATAATAGGGGGCTGGGTGG + Intronic
975228950 4:71908177-71908199 GTGAATAAAAGGGAGGAGGAAGG + Intergenic
977922494 4:102660874-102660896 GCAAAGATTAGGGAGGTGAGAGG - Intronic
981253620 4:142634028-142634050 ATAAAAAGGAGGGAGGTGGGGGG + Intronic
981846246 4:149173449-149173471 GAAAAAAATGGGGATGTGGGTGG + Intergenic
987715485 5:21563924-21563946 GTAATTAGTAGGGTGGTGGGAGG + Intergenic
988276720 5:29090480-29090502 ATAAAGAATAGGGATTTGGGGGG - Intergenic
988617288 5:32786959-32786981 GTAAATATTAGTGAGATGGGAGG + Exonic
989570708 5:42943810-42943832 TTAGATTACAGGGAGGTGGGTGG - Intergenic
990041938 5:51387248-51387270 GTAAAAGAAAGGGAGGAGGGAGG + Intronic
990049284 5:51476734-51476756 ATAATTAATAGGGAGGAGAGAGG - Intergenic
991098532 5:62765432-62765454 ATACATAAAAGGGAGGTGGTAGG + Intergenic
995984534 5:118153502-118153524 GTAAATATCAAGGAGATGGGAGG + Intergenic
996375500 5:122802360-122802382 GGAAATGATGGGGAGGAGGGGGG + Intronic
996484880 5:124021209-124021231 CTAAAGAATAGAGAAGTGGGTGG - Intergenic
996648027 5:125840872-125840894 GTATAGGATAGGGAGGTGTGAGG - Intergenic
997068626 5:130592965-130592987 GAAAATAATGTGGAGGTGGCTGG + Intergenic
998857531 5:146407903-146407925 GAAAAAAATAGGGAGGAGGGGGG - Intergenic
999136423 5:149322910-149322932 GAAAATGACAGGGAGTTGGGGGG + Intronic
999757168 5:154673157-154673179 ATAAATAAGACTGAGGTGGGCGG - Intergenic
1000385755 5:160673257-160673279 GAAAAGAAAAGGGATGTGGGTGG - Intronic
1001825743 5:174743459-174743481 GCAAATGGGAGGGAGGTGGGAGG - Intergenic
1002300161 5:178253284-178253306 GCACAGGATAGGGAGGTGGGAGG - Intronic
1002930148 6:1628422-1628444 GAAAGTGATATGGAGGTGGGAGG - Intronic
1003557358 6:7152085-7152107 CTAAATAATAGGGAGTTCTGGGG + Intronic
1003993766 6:11516696-11516718 GTAAATGTTAAGGAGGTGTGAGG + Intergenic
1004922466 6:20388808-20388830 GTAAATAATATGGGGTGGGGAGG + Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1006750386 6:36373245-36373267 GCAGAGAATGGGGAGGTGGGAGG + Intronic
1007282231 6:40721058-40721080 GTTAATAATAAGGGGGTGAGGGG + Intergenic
1008029426 6:46676953-46676975 GTAAATTAAAGGGAGGTGAATGG + Exonic
1009001238 6:57718120-57718142 GTAATTAGTAGGGTGGTGGGAGG - Intergenic
1009327041 6:62364454-62364476 ATAAATAAAAGGGAGGTCGGGGG + Intergenic
1010777212 6:79901172-79901194 GTTATTAATAGTGAGGTGGCAGG - Intergenic
1011701128 6:89955869-89955891 AAAAATAAGAGGGGGGTGGGAGG + Intronic
1012817228 6:104039445-104039467 CTAGATAAAAGGGAGGAGGGAGG + Intergenic
1012886204 6:104849043-104849065 GTAAATATCAGGGATGCGGGAGG + Intronic
1014213891 6:118734944-118734966 GTAAGTGGTAGGGAGGAGGGTGG + Intergenic
1014354621 6:120390413-120390435 GTATGTCATAGGGAGGTGTGAGG - Intergenic
1014592306 6:123289431-123289453 GTCAATAATAATGAGGTAGGGGG + Intronic
1015436368 6:133193744-133193766 GAAATTAATAGGGAGGTAAGAGG + Intergenic
1015671848 6:135699699-135699721 AAAAATAATAAGCAGGTGGGTGG + Intergenic
1015743125 6:136480397-136480419 GAAAATATTGGGGAGATGGGTGG + Intronic
1016826402 6:148392346-148392368 GTAGATAAACAGGAGGTGGGAGG - Intronic
1017991802 6:159495250-159495272 TTAAATAAGAGGGAGCTAGGGGG - Intergenic
1018696507 6:166395647-166395669 CTAAAAGAGAGGGAGGTGGGTGG + Intergenic
1021396302 7:20152694-20152716 GTAAATAATGGAAAAGTGGGTGG + Intronic
1021676642 7:23086789-23086811 AAAAATAACAAGGAGGTGGGAGG + Intergenic
1022301272 7:29104768-29104790 ATAAGGAATAGGGAAGTGGGCGG + Intronic
1022404879 7:30079496-30079518 GTAAATGGTAGGCAGTTGGGAGG - Exonic
1024816855 7:53281779-53281801 CTAAATCATAAGGAGGAGGGTGG - Intergenic
1025767409 7:64468345-64468367 TAAAATAAAAAGGAGGTGGGGGG + Intergenic
1029333534 7:99880347-99880369 TTAAATAAAAGGGAAGTGTGTGG - Intronic
1031206853 7:118770106-118770128 GTAAATACTTGGGTGGTGGTTGG + Intergenic
1031539218 7:122972810-122972832 TTACATAATCAGGAGGTGGGGGG - Intergenic
1032408374 7:131674285-131674307 GTGAATGATAGGCAGGGGGGAGG + Intergenic
1032486594 7:132292268-132292290 GTAAATCAGAGGGAGGCTGGAGG + Intronic
1032515196 7:132501658-132501680 GCCAAAAAGAGGGAGGTGGGCGG + Intronic
1033310856 7:140260778-140260800 GTAAAGAAAAGGGCGGGGGGGGG - Intergenic
1036480142 8:9132264-9132286 GAAAATATTTGGGAGATGGGAGG + Intergenic
1036710847 8:11077674-11077696 CTTAATAAGAGGGAGCTGGGCGG - Intronic
1036730434 8:11258495-11258517 GTAAATAATAGGGAAATGTGAGG + Intergenic
1037520332 8:19674724-19674746 GGAAATAATTGGGAGCAGGGAGG + Intronic
1038076417 8:24080189-24080211 ATGTATAATAGGGAGGTTGGGGG + Intergenic
1038080566 8:24130853-24130875 TTTAATGCTAGGGAGGTGGGAGG + Intergenic
1038700010 8:29841166-29841188 CCAAATAATAGAGAGGTGGAAGG - Intergenic
1041761080 8:61367080-61367102 GGAAATAATAGAGATGTGGGAGG - Intronic
1045211873 8:100107228-100107250 GAAGATAATGGAGAGGTGGGAGG + Intronic
1045990948 8:108307119-108307141 ATAGATAATAGGAAGGGGGGAGG - Intronic
1046138267 8:110059843-110059865 GTAGATAATACTGAGATGGGAGG + Intergenic
1046324546 8:112623657-112623679 GAATAAAATAGGGAGGGGGGAGG - Intronic
1046977429 8:120297123-120297145 GTAAATAATTGTGTAGTGGGAGG + Intronic
1047041995 8:121006805-121006827 GGAAATAATTGGCAGGTGGTAGG + Intergenic
1048252766 8:132880459-132880481 GCCACTAATAGGGAGGTAGGGGG - Intronic
1048706967 8:137164587-137164609 GAAATGAATAGGGATGTGGGGGG - Intergenic
1051729895 9:20130357-20130379 GAAAATAATAGGGAGAGAGGGGG + Intergenic
1051864446 9:21663699-21663721 ATAAATAATAGGTAGGAGGCAGG - Intergenic
1052280253 9:26724724-26724746 GTAAATGAGATGGGGGTGGGGGG - Intergenic
1054785524 9:69206536-69206558 ATAAAAAATAGGGAGATGAGTGG - Intronic
1055733760 9:79306220-79306242 GTAGATAATTGGGATGTAGGTGG - Intergenic
1057288572 9:93782582-93782604 GAAGATAGTAGGGAGGTTGGAGG - Intergenic
1057792601 9:98134050-98134072 TTGGATAAAAGGGAGGTGGGGGG - Intronic
1058929579 9:109705617-109705639 GTAAGTCATAGGGAGGTGCCTGG - Intronic
1060010558 9:120039882-120039904 GGGAAAACTAGGGAGGTGGGAGG - Intergenic
1060809473 9:126603059-126603081 GAAAAAAAAAGTGAGGTGGGGGG - Intergenic
1060919388 9:127409323-127409345 GAAGATGATGGGGAGGTGGGGGG + Intergenic
1060919403 9:127409364-127409386 GGAGATGATGGGGAGGTGGGGGG + Intergenic
1060919417 9:127409405-127409427 GTAGACGATGGGGAGGTGGGGGG + Intergenic
1060919474 9:127409553-127409575 GGAGATGATGGGGAGGTGGGGGG + Intergenic
1060919492 9:127409606-127409628 GGAGATGATGGGGAGGTGGGGGG + Intergenic
1061697285 9:132386170-132386192 TGAAATAGGAGGGAGGTGGGTGG + Intronic
1062494809 9:136826727-136826749 GACAATGATAGGGCGGTGGGTGG - Intronic
1203747611 Un_GL000218v1:51788-51810 GTAAGTACTAGGGGGCTGGGGGG - Intergenic
1185633888 X:1537351-1537373 GCCAGTGATAGGGAGGTGGGCGG - Intergenic
1187796752 X:23012277-23012299 GGACATAAGAGGGAGGTGGTGGG - Intergenic
1188054854 X:25528922-25528944 AGAAATAATAGTGAGGTGAGGGG + Intergenic
1188565691 X:31523639-31523661 ACAAATAACAGAGAGGTGGGTGG + Intronic
1189826805 X:44927095-44927117 GTAAATATGACGGGGGTGGGAGG - Intronic
1190707409 X:53041875-53041897 GGAAAAAATAGAGTGGTGGGGGG + Intergenic
1192452694 X:71253692-71253714 GTAAAGACTGGGGAGCTGGGGGG - Intronic
1194262263 X:91710848-91710870 GTTAAGAATAGGGAGTTGTGAGG - Intergenic
1194431122 X:93807259-93807281 GTATATATTTGGGATGTGGGAGG - Intergenic
1194746820 X:97637225-97637247 GAAAAAAACAGGGAGGTAGGAGG + Intergenic
1196376449 X:115038397-115038419 GTAAAAAACAGGAAGGTGGGTGG + Intergenic
1197462239 X:126756905-126756927 GTATATAATAGGGTGGGGGCAGG - Intergenic
1198745429 X:139885284-139885306 GTAAATGGCAGGGTGGTGGGGGG - Intronic
1198874978 X:141214633-141214655 GCAAAAATAAGGGAGGTGGGAGG + Intergenic
1200581557 Y:4955681-4955703 GTTAAGAATAGGGAGTTGTGAGG - Intergenic
1201160938 Y:11166774-11166796 GTAAGTACTAGGGGGCTGGGGGG - Intergenic