ID: 936002889

View in Genome Browser
Species Human (GRCh38)
Location 2:108851591-108851613
Sequence CCGCGCCCGGCCTTTCTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 173}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936002878_936002889 22 Left 936002878 2:108851546-108851568 CCCACCTCAGCCTCCCAAAAGTG 0: 104
1: 402
2: 1174
3: 6659
4: 60968
Right 936002889 2:108851591-108851613 CCGCGCCCGGCCTTTCTCTTGGG 0: 1
1: 0
2: 3
3: 29
4: 173
936002880_936002889 18 Left 936002880 2:108851550-108851572 CCTCAGCCTCCCAAAAGTGCTGA 0: 14
1: 268
2: 677
3: 1188
4: 1929
Right 936002889 2:108851591-108851613 CCGCGCCCGGCCTTTCTCTTGGG 0: 1
1: 0
2: 3
3: 29
4: 173
936002882_936002889 9 Left 936002882 2:108851559-108851581 CCCAAAAGTGCTGATATTACAGG 0: 2
1: 71
2: 1327
3: 5912
4: 5771
Right 936002889 2:108851591-108851613 CCGCGCCCGGCCTTTCTCTTGGG 0: 1
1: 0
2: 3
3: 29
4: 173
936002877_936002889 25 Left 936002877 2:108851543-108851565 CCGCCCACCTCAGCCTCCCAAAA 0: 1534
1: 29525
2: 95130
3: 180299
4: 195214
Right 936002889 2:108851591-108851613 CCGCGCCCGGCCTTTCTCTTGGG 0: 1
1: 0
2: 3
3: 29
4: 173
936002881_936002889 12 Left 936002881 2:108851556-108851578 CCTCCCAAAAGTGCTGATATTAC 0: 2
1: 52
2: 786
3: 1730
4: 4511
Right 936002889 2:108851591-108851613 CCGCGCCCGGCCTTTCTCTTGGG 0: 1
1: 0
2: 3
3: 29
4: 173
936002884_936002889 8 Left 936002884 2:108851560-108851582 CCAAAAGTGCTGATATTACAGGC 0: 138
1: 14894
2: 249727
3: 277711
4: 175494
Right 936002889 2:108851591-108851613 CCGCGCCCGGCCTTTCTCTTGGG 0: 1
1: 0
2: 3
3: 29
4: 173
936002879_936002889 21 Left 936002879 2:108851547-108851569 CCACCTCAGCCTCCCAAAAGTGC 0: 149
1: 413
2: 705
3: 1415
4: 11090
Right 936002889 2:108851591-108851613 CCGCGCCCGGCCTTTCTCTTGGG 0: 1
1: 0
2: 3
3: 29
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936002889 Original CRISPR CCGCGCCCGGCCTTTCTCTT GGG Intronic
901394808 1:8973307-8973329 CTGTGCCCGGCCTGTCTCCTAGG + Intronic
901837390 1:11933392-11933414 CCGTGCCCGGCCTCTGTCTGAGG + Intergenic
902284060 1:15395021-15395043 CCGCACCCAGCCTTTCCCATAGG - Intronic
902580474 1:17404563-17404585 CCGTGCCCGGCCTTTGGCTCTGG - Intergenic
903971810 1:27123799-27123821 CCGCGCCCAGCCCTTTTATTGGG + Intronic
907912056 1:58835477-58835499 GCGGTCCAGGCCTTTCTCTTGGG + Intergenic
911198917 1:95024265-95024287 CCGCGCCCGGCCTTTTAAATAGG + Intronic
914712044 1:150223388-150223410 CCGCGCCCGGCCCTTTAGTTAGG - Intronic
916298158 1:163243355-163243377 CCGCGCCCGGCCTGTCATCTAGG - Intronic
921099331 1:211914846-211914868 CCACGCCCAGCCTTTTTTTTAGG + Intergenic
923494272 1:234510859-234510881 CCGCGCCTGGCCTCTCTCTACGG + Intergenic
923793972 1:237135664-237135686 CCGCGCCCGGCCCCCCTCGTTGG + Intronic
1062774708 10:135504-135526 CCGCGCCCGGCCCTCCCCTCCGG - Intronic
1064374351 10:14782366-14782388 CCGCGCCCGGCCTATCTAGATGG - Intergenic
1064800476 10:19064995-19065017 CCGCACCCGGCCCTTTTCTAGGG - Intronic
1065227202 10:23556373-23556395 CCGTGCCCAGCCTTTCTCCAAGG + Intergenic
1065590981 10:27260462-27260484 CCGCGCCCGGCCTCACCCTGAGG + Intergenic
1065728866 10:28692507-28692529 CTGCGCCCGGCCTGGATCTTTGG - Intergenic
1065821993 10:29534210-29534232 CAGGGCCCGGCCTCTCTTTTGGG - Intronic
1067945334 10:50685251-50685273 CCCAGCCTGGCCTTCCTCTTGGG + Intergenic
1068281057 10:54870493-54870515 CCGCGCCCGGTCTTTTTATGTGG - Intronic
1069719740 10:70541766-70541788 CCCTGCCCGGCCTTGCTGTTGGG + Intronic
1069775734 10:70926081-70926103 CCGCGTGGGGCCTTTCTCTGGGG + Intergenic
1070111651 10:73492983-73493005 CCGCGCCCGGCCTGCCTCCCTGG - Intronic
1070866844 10:79712123-79712145 CCCAGCCTGGCCTTCCTCTTGGG + Exonic
1070880634 10:79850244-79850266 CCCAGCCTGGCCTTCCTCTTGGG + Exonic
1071540520 10:86478802-86478824 CCACGCCCGGCCTTTTCCTCTGG - Intronic
1071633756 10:87234346-87234368 CCCAGCCTGGCCTTCCTCTTGGG + Exonic
1071647204 10:87366562-87366584 CCCAGCCTGGCCTTCCTCTTGGG + Exonic
1076995472 11:295514-295536 CCCTGCCCAGCCTTTGTCTTGGG + Exonic
1077076942 11:706252-706274 CCGCGCTCGGCCTGTCCCCTCGG - Exonic
1079025476 11:16944354-16944376 CCGCGCCCGGCTTATTTTTTGGG - Intronic
1083409920 11:62485077-62485099 CCGTGCCTGGCCTTTGACTTAGG + Intronic
1083457392 11:62788110-62788132 CCGCGCCCGGCGGATCTCTGAGG - Intronic
1083853824 11:65382375-65382397 CCGCACCCGGCCTCTCTCTGTGG - Intronic
1085249462 11:75132794-75132816 CCGCGCCCGGCCTTCATTATGGG - Intronic
1087755030 11:102046537-102046559 CCGCACCCGGCCTGTTTCTATGG - Intergenic
1087760343 11:102098575-102098597 CCGTGCCCGGCCTTTTTTTTTGG - Intergenic
1088878277 11:113953718-113953740 CTGCGCCCGGCCTCACTCTTTGG + Intergenic
1088959717 11:114650813-114650835 CCGGGTCCAGCCTTTGTCTTTGG - Intergenic
1089311066 11:117558473-117558495 CCGTGCCCAGCCATTATCTTTGG - Intronic
1089641225 11:119848469-119848491 CCACACCCAGCCTTTCTCTTAGG - Intergenic
1090983899 11:131748925-131748947 CCCGGCTCGGCCTTTCTCTTGGG + Intronic
1092208903 12:6633701-6633723 CTGTGCCCGGCCATTCTCCTGGG + Intronic
1094587038 12:31787080-31787102 CTGCGCCCGGCCTCTTTTTTTGG - Intergenic
1095882226 12:47150283-47150305 CCGCGCCCGGCCTATTTCTTTGG - Intronic
1096811980 12:54176514-54176536 CCGTGCCCGGCCTTTTTTTTTGG - Intronic
1097024878 12:56047495-56047517 CCGCGCCCGGCCTATCTGGCAGG - Intergenic
1100612588 12:96203648-96203670 CCGCGCCCAGCCTGTCTTTATGG - Intronic
1102411743 12:112726083-112726105 CCGCACCCAGCCTTTTTTTTCGG + Intronic
1104468054 12:129005914-129005936 CAGAGCCCGGCCTTTCTCAGGGG + Intergenic
1105347221 13:19585062-19585084 CCAGGCCCTGCCTTTCTCTGTGG + Intergenic
1105748637 13:23400708-23400730 CCGCGCCCGGCCAGTCACTTTGG + Intronic
1107767764 13:43756135-43756157 CCATGCCCAGCCTTTTTCTTTGG - Intronic
1107857940 13:44633920-44633942 CCGCGCCCGGCCCTGTTTTTTGG - Intergenic
1108693145 13:52878150-52878172 CCGCGCCCGGCCGGTATTTTCGG + Intergenic
1115556642 14:34549533-34549555 CTGCGCCCGGCCTCTATCTCTGG + Intergenic
1125503448 15:40253229-40253251 CCGCACTGGGCCTCTCTCTTAGG - Exonic
1126584208 15:50266927-50266949 CTGCGCCCGGCCCATTTCTTAGG + Intergenic
1131602413 15:93862968-93862990 CCGCGCTCTTCCTTCCTCTTGGG - Intergenic
1132002218 15:98191742-98191764 ACGCGCTCTGCTTTTCTCTTGGG - Intergenic
1132918150 16:2365890-2365912 CTGCCCCCGGCTTTTCTCTGTGG + Intergenic
1134380291 16:13718141-13718163 CCGCGCCCGGCCTCTGTTTTGGG + Intergenic
1134885757 16:17789995-17790017 CCGCTCCTGGAGTTTCTCTTTGG - Intergenic
1137303288 16:47174808-47174830 CCGCGCCCGGCCTCTCTGAAAGG + Intronic
1139817578 16:69687902-69687924 CCGCGCCCGGCCAAACTCCTGGG - Intronic
1140936551 16:79675974-79675996 CCGCGCCCGGCCAATTTCTAAGG + Intergenic
1141576482 16:84967122-84967144 CCGCGCCCGGCCTAACCCCTGGG - Intergenic
1141967718 16:87458240-87458262 CCACGGCAGGCCTTTCTCCTGGG + Intronic
1142287528 16:89177492-89177514 AGGCTCCCGGCCTTTCTCTCGGG - Intronic
1145879094 17:28341033-28341055 CCGCACCCGGCCTGGATCTTGGG + Intronic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1148209332 17:45798776-45798798 CCGCCCCCGGCCTTTCTCCCTGG - Intronic
1149680427 17:58503355-58503377 CCGTGCCCGGCCTCTTTCTGAGG - Intronic
1150530967 17:65981104-65981126 CCACGCCCGGCCATCTTCTTAGG + Intronic
1151285935 17:73111170-73111192 CCGTGCCTGGCTTTTCTCCTTGG - Intergenic
1151301251 17:73228618-73228640 CTGCTCCCCACCTTTCTCTTAGG + Intronic
1152198751 17:78933166-78933188 CCACGCCCGGCCTTCCCTTTGGG + Intergenic
1152464812 17:80460024-80460046 CCGCGCCCGGCCTTTCATTGTGG - Intergenic
1158653476 18:59308066-59308088 CCGCGTCCGGCCTCTCTCTAAGG + Intronic
1160204991 18:76824143-76824165 CCAGGCCCGACCTTTCTCTGGGG - Exonic
1160835475 19:1122742-1122764 CAGCGCGCGGGCTTTCTCATCGG - Exonic
1160864055 19:1249475-1249497 CCGCTCCCGGCCGCTCCCTTGGG + Intronic
1161070466 19:2257367-2257389 CCGCGCCCGGCCATTCACTCAGG - Intronic
1161547960 19:4893750-4893772 CCGCACCCGGCCTTCCTTTTTGG - Intronic
1161938280 19:7385764-7385786 CCGCGCCTGGCCTGTCACCTGGG + Intronic
1162574858 19:11493346-11493368 CCGTGCCCAGCCTTTGTTTTGGG + Intronic
1162918394 19:13886256-13886278 CTGCGCCCGTCCTTTCCCCTTGG + Intronic
1163222289 19:15930298-15930320 CCACGCCCGGCCATTATCTTTGG - Intronic
1164279871 19:23759810-23759832 CCGCGCCCGGCCTATATATCAGG + Intergenic
1165392852 19:35548298-35548320 CGGCTCCCCGCCTTTCTCTGAGG + Intergenic
1165395166 19:35559920-35559942 GCGGGCCTGGCCATTCTCTTCGG - Exonic
1167747668 19:51361990-51362012 CCAGGCCCAGCCTTTCTCCTGGG + Intronic
925176340 2:1786712-1786734 CCTCGCCCGGCCTTCCTATTCGG - Intergenic
927236789 2:20882199-20882221 CTGCTCCCCGCATTTCTCTTTGG - Intergenic
928556058 2:32426310-32426332 CCACACCCGGCCATTCTGTTGGG - Intronic
934743832 2:96745326-96745348 CTGCGCCCAGCCCTGCTCTTTGG - Intergenic
935127389 2:100236302-100236324 CTGCTCCAGGCCCTTCTCTTTGG - Intergenic
935167556 2:100582446-100582468 CCGCACCCGGCCTTTTTTTGGGG - Intergenic
936002889 2:108851591-108851613 CCGCGCCCGGCCTTTCTCTTGGG + Intronic
942756486 2:179347501-179347523 CTGTGCCAGGCCTCTCTCTTTGG + Intergenic
943859631 2:192844377-192844399 CTGCTCCAGGCCTTTCTCCTTGG + Intergenic
945295598 2:208168381-208168403 CCGCGCCCGGCCCAACTCTTGGG - Intronic
946926461 2:224631873-224631895 CCGCGCCCGGCCTGACTCCAAGG + Intergenic
947659396 2:231855460-231855482 CAGCCCCAGGCCTTTCTTTTGGG - Intergenic
947721377 2:232371382-232371404 CTGCGCCTGGCCTTTATATTTGG - Intergenic
948984314 2:241510770-241510792 CCACGCTCGGCCTTATTCTTCGG + Intergenic
1169519101 20:6351874-6351896 CCGCGCCAGGCCTATTTCTGTGG + Intergenic
1170977759 20:21182503-21182525 CTGCGCCTGGCCTTACTATTTGG - Intronic
1171983876 20:31645852-31645874 CCACGCCCGGCCTTTTTTATTGG + Intergenic
1172253214 20:33494569-33494591 CCGCGCCCGGCCACTGTATTAGG + Intronic
1172269522 20:33646288-33646310 CCATGCCCGGCCTGTCTTTTTGG + Exonic
1173795115 20:45854497-45854519 CCGCGCCCGGCCTCACACATAGG + Intronic
1174403236 20:50287500-50287522 CTGCGTCCGGCCATTCTCTAAGG + Intergenic
1176302042 21:5103020-5103042 CCCCGCCAGGCCTGTCTCTAAGG - Intergenic
1178414466 21:32392879-32392901 CCGCCCGAGGCCTTCCTCTTGGG + Exonic
1178592800 21:33925525-33925547 CCGCCCCCGGCCTTCCATTTTGG + Intergenic
1178964411 21:37102704-37102726 CTGCACCTGGCCTTACTCTTTGG - Intronic
1179854987 21:44158880-44158902 CCCCGCCAGGCCTGTCTCTAAGG + Intergenic
1181675038 22:24445821-24445843 CCTGGCCTGGCCTTTCTCCTAGG - Intergenic
1183291587 22:37004976-37004998 CCGTGCCCGGCCTGTGACTTCGG + Intronic
1183657740 22:39198993-39199015 CCGCGCCCGGCCAATTCCTTGGG - Intergenic
1183900886 22:41005118-41005140 CCCTGCCCTGCCTTACTCTTGGG + Intergenic
1184416529 22:44355111-44355133 CCGCGCCTGGCCTGTCCCTGTGG + Intergenic
1184618947 22:45659391-45659413 CCGCGCCCGGCCTGTCTGCAGGG + Intergenic
1185333456 22:50261653-50261675 CCGCTCCCGGCCCTTCCCTCAGG + Exonic
959039497 3:101404930-101404952 CTGTGCCAGGCCTCTCTCTTTGG - Intronic
961153915 3:124662854-124662876 CTGCCCCAGGCCTTTCTCTTTGG + Intronic
961762827 3:129184063-129184085 CCGCGCGCGGCCTTTCACGCCGG + Intergenic
961831793 3:129626874-129626896 CCGCTTCCGGCCTCTCTCTGCGG - Intergenic
963831281 3:150012224-150012246 CCTTTCCCAGCCTTTCTCTTTGG + Intronic
964101845 3:152996502-152996524 CTGCGCCCGGCCGTTATCTATGG - Intergenic
967230599 3:187334216-187334238 CCGAGCCCAGCCTCTCTCCTGGG - Intergenic
968196580 3:196712239-196712261 GCGCGCCCGGCCTGTCGCTGTGG - Exonic
968665579 4:1820223-1820245 CCGCGCCCAGCCTCTCTGTTTGG + Intronic
968770154 4:2500298-2500320 CAGCCCCAGGCCTTTCTCTTTGG - Intronic
970113417 4:12664262-12664284 CCGCGCCCGGCCTTTTGTGTGGG + Intergenic
971065410 4:23026723-23026745 CCGCGCCCGGCCATTTTCCTTGG - Intergenic
972446633 4:39150577-39150599 CCGCACCCGGCCTTTACCTGTGG - Intergenic
974892056 4:67894366-67894388 CCGCGCCAGGCCTTTCATTGTGG + Intergenic
974991381 4:69094436-69094458 CCGCGCCCGGCCGGTTTCTAAGG + Intronic
975318421 4:72981771-72981793 CTGCGCCCGGCCTCTGTTTTTGG - Intergenic
975557086 4:75675500-75675522 CCGCGCCCGGCCTATATCAGTGG - Intronic
975714594 4:77193519-77193541 ACGCCCCAGGGCTTTCTCTTGGG - Intronic
975839630 4:78459783-78459805 CCGCCCCAGGCCTCTCTCCTTGG + Intronic
978572385 4:110152518-110152540 CCACGCCCGGCCTTTCTGCCAGG + Intronic
979539990 4:121870250-121870272 CGGCGCCCGCCCTATCCCTTGGG + Intronic
982256770 4:153458506-153458528 CCGCGCCCGGCCTGACTCCTTGG + Intergenic
982257716 4:153466561-153466583 CCGCCCCCGCTCTTTCTTTTAGG + Intronic
985489046 5:168349-168371 GCGCCCCCGGCCTTGCTCTCCGG + Intronic
987123181 5:14787021-14787043 CCGCACCCGGCCTGTTTCTTGGG - Intronic
990858920 5:60303595-60303617 CCGCGCCCGGCCTCTATGTCTGG + Intronic
992283179 5:75203371-75203393 CCGCGCCCGGCCTCCCCTTTGGG - Intronic
992800560 5:80291964-80291986 CCGCGCCTGGCCTTGCTGTAAGG - Intergenic
997583791 5:135033244-135033266 TCCCGCCCGCCCCTTCTCTTTGG + Intronic
998183171 5:139959664-139959686 CCGCGCCTGGCTTTTTTTTTTGG + Intronic
998233113 5:140374267-140374289 CCGTGCCTGGCCTGGCTCTTAGG - Intronic
998240879 5:140443398-140443420 CCACGCCCGGCCTTTTTTTTGGG - Intronic
998467516 5:142357371-142357393 CCGCGCGCCGCCCTTCTCTCCGG + Intergenic
998643211 5:144035363-144035385 CTGCTCCCGGCCTTTCTCTTTGG - Intergenic
999336876 5:150727484-150727506 CCGCGCCCGGCCTGCTTATTGGG - Intronic
1006626118 6:35399110-35399132 CTACGCCCGGCCTTTTTTTTGGG - Intronic
1010214834 6:73392592-73392614 CCGCGCCTGGCCTATTTCCTAGG + Intronic
1010634982 6:78248047-78248069 CTGCTCCAGGCCTTTCTCTTTGG - Intergenic
1013754480 6:113444723-113444745 CCGCGCCCAGCCTTCTTCTAGGG + Intergenic
1014364799 6:120525706-120525728 CTGCGCCCGGCCAGTTTCTTAGG + Intergenic
1015400362 6:132781466-132781488 CCGTGCCCGGCCCTTTTCTGGGG - Intronic
1017714834 6:157201674-157201696 CCGCGCCCGGCCAATCTTTCTGG - Intronic
1018797221 6:167196004-167196026 CCGCCTCCGCCCTTTCTCTGAGG + Intronic
1020389539 7:7643418-7643440 CCGCGCCCGGCCCTGATCCTAGG - Intronic
1021593485 7:22290453-22290475 CCGCGCCCGGCCTTTCATTGTGG - Intronic
1022459388 7:30590566-30590588 CCGCGCCCGGCCGATTCCTTAGG - Intergenic
1022905424 7:34850688-34850710 CCGCGCCCGGCCTGTCCTTGAGG + Intronic
1024259783 7:47565363-47565385 CCGCGCCCGGCCTTTTTTTTTGG + Intronic
1024344048 7:48294734-48294756 CCGCGCCCGGCCCGTTTCTATGG + Intronic
1025977163 7:66378373-66378395 CCACGCCCAGCTTTTCCCTTTGG - Intronic
1026500901 7:70942660-70942682 CCGCGCCTGGCCTCTGTGTTGGG - Intergenic
1030050166 7:105530761-105530783 CTGCGCCCGGCCTTTTTTTCTGG - Intergenic
1031913655 7:127542870-127542892 CCGCGCCCAGCCTCTATCTGAGG - Intergenic
1032368844 7:131326638-131326660 CCGGGCCTGGCCTTTCTATCTGG + Intronic
1032470619 7:132175769-132175791 CCCTGCTCCGCCTTTCTCTTTGG + Intronic
1032576603 7:133061129-133061151 CCCACCCCGGCCTTCCTCTTAGG - Intronic
1034289844 7:149921044-149921066 CCGTGCCCGGCCTATCTTTCAGG + Intergenic
1034661219 7:152771783-152771805 CCGTGCCCGGCCTATCTTTCAGG - Intronic
1040435945 8:47391704-47391726 CCACGCCCGGCCTTTTTTCTTGG - Intronic
1045741049 8:105359662-105359684 CCGCGCCCGGCCCCACTCTGGGG + Intronic
1049792999 8:144481177-144481199 CCGCGCCCGGCCTGTTTGATGGG + Intronic
1055484776 9:76746413-76746435 CCGCGCCCGGCCGCTCTTTGGGG - Intronic
1056389525 9:86127637-86127659 CTGCGCCTGGCCTTGCCCTTAGG - Intergenic
1057186667 9:93061010-93061032 CCGCGCCCTGCCCTTCTCCCAGG - Intronic
1057763524 9:97895870-97895892 CCCAGCCTGGCCTTTCTCCTAGG + Intergenic
1057777405 9:98022096-98022118 CTGCTCCAGGCCTTTCTCCTTGG + Intergenic
1059236333 9:112763558-112763580 CGGCGCCCGGCCTGTCACTCAGG - Intronic
1060089772 9:120732616-120732638 CCGCACCCGGCCTTGCTTTCAGG + Intergenic
1060724683 9:125999152-125999174 CCGTGCCCCGCCTTTGCCTTCGG + Intergenic
1060774785 9:126365040-126365062 CCGCGCCTGGCCTGTTTTTTGGG + Intronic
1060968623 9:127725272-127725294 CCGTGCCCAGCCTTTTTTTTTGG - Intronic
1061131590 9:128711586-128711608 CCACGCCCGGCCTTTTTTTTGGG + Intronic
1061672301 9:132195615-132195637 CCGCGCCTGGCCTTTGTTTTGGG + Intronic
1061961864 9:133992664-133992686 CCCCGCCGGGCCTTTGTCTCGGG - Intergenic
1062420976 9:136482731-136482753 CCGCGTCCGGCCTTCCGCTCTGG + Intronic
1185890688 X:3819379-3819401 CCGCGCCCGGCCTCCCTCAAGGG - Intronic
1190315750 X:49149658-49149680 CCGCGCCCAGCCTTTTTTTTTGG - Intergenic
1191996589 X:67102195-67102217 CCAATCCCTGCCTTTCTCTTTGG + Intergenic
1199448812 X:147956979-147957001 GCGCTACCGGCCTTGCTCTTAGG + Intergenic
1200096931 X:153668917-153668939 CCCCTCTAGGCCTTTCTCTTGGG - Intergenic