ID: 936006896

View in Genome Browser
Species Human (GRCh38)
Location 2:108897104-108897126
Sequence TCAGGCCGAAGCTCTCGGCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 35}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936006892_936006896 -7 Left 936006892 2:108897088-108897110 CCAATCTCATCCCTCTTCAGGCC 0: 1
1: 0
2: 1
3: 24
4: 299
Right 936006896 2:108897104-108897126 TCAGGCCGAAGCTCTCGGCGAGG 0: 1
1: 0
2: 1
3: 5
4: 35
936006889_936006896 -5 Left 936006889 2:108897086-108897108 CCCCAATCTCATCCCTCTTCAGG 0: 1
1: 0
2: 3
3: 20
4: 246
Right 936006896 2:108897104-108897126 TCAGGCCGAAGCTCTCGGCGAGG 0: 1
1: 0
2: 1
3: 5
4: 35
936006891_936006896 -6 Left 936006891 2:108897087-108897109 CCCAATCTCATCCCTCTTCAGGC 0: 1
1: 0
2: 0
3: 14
4: 209
Right 936006896 2:108897104-108897126 TCAGGCCGAAGCTCTCGGCGAGG 0: 1
1: 0
2: 1
3: 5
4: 35
936006888_936006896 -4 Left 936006888 2:108897085-108897107 CCCCCAATCTCATCCCTCTTCAG 0: 1
1: 1
2: 1
3: 31
4: 339
Right 936006896 2:108897104-108897126 TCAGGCCGAAGCTCTCGGCGAGG 0: 1
1: 0
2: 1
3: 5
4: 35
936006887_936006896 8 Left 936006887 2:108897073-108897095 CCGTCTGTCATGCCCCCAATCTC 0: 1
1: 0
2: 1
3: 28
4: 408
Right 936006896 2:108897104-108897126 TCAGGCCGAAGCTCTCGGCGAGG 0: 1
1: 0
2: 1
3: 5
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936006896 Original CRISPR TCAGGCCGAAGCTCTCGGCG AGG Exonic