ID: 936008605

View in Genome Browser
Species Human (GRCh38)
Location 2:108910677-108910699
Sequence ATGTGAGAGCAGAAGCAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 293}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936008603_936008605 4 Left 936008603 2:108910650-108910672 CCCACGGTAAGCACAGTATGGTT 0: 1
1: 0
2: 0
3: 4
4: 46
Right 936008605 2:108910677-108910699 ATGTGAGAGCAGAAGCAGCGAGG 0: 1
1: 0
2: 0
3: 18
4: 293
936008604_936008605 3 Left 936008604 2:108910651-108910673 CCACGGTAAGCACAGTATGGTTC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 936008605 2:108910677-108910699 ATGTGAGAGCAGAAGCAGCGAGG 0: 1
1: 0
2: 0
3: 18
4: 293
936008597_936008605 26 Left 936008597 2:108910628-108910650 CCCGGTGTCTGTGTGGCACCACC 0: 1
1: 0
2: 0
3: 19
4: 198
Right 936008605 2:108910677-108910699 ATGTGAGAGCAGAAGCAGCGAGG 0: 1
1: 0
2: 0
3: 18
4: 293
936008602_936008605 5 Left 936008602 2:108910649-108910671 CCCCACGGTAAGCACAGTATGGT 0: 1
1: 0
2: 0
3: 2
4: 38
Right 936008605 2:108910677-108910699 ATGTGAGAGCAGAAGCAGCGAGG 0: 1
1: 0
2: 0
3: 18
4: 293
936008598_936008605 25 Left 936008598 2:108910629-108910651 CCGGTGTCTGTGTGGCACCACCC 0: 1
1: 0
2: 1
3: 17
4: 162
Right 936008605 2:108910677-108910699 ATGTGAGAGCAGAAGCAGCGAGG 0: 1
1: 0
2: 0
3: 18
4: 293
936008600_936008605 8 Left 936008600 2:108910646-108910668 CCACCCCACGGTAAGCACAGTAT 0: 1
1: 0
2: 0
3: 3
4: 58
Right 936008605 2:108910677-108910699 ATGTGAGAGCAGAAGCAGCGAGG 0: 1
1: 0
2: 0
3: 18
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936008605 Original CRISPR ATGTGAGAGCAGAAGCAGCG AGG Intronic
903186002 1:21629427-21629449 ATGTGGGTGCAGAACCAGAGCGG + Intronic
903552234 1:24165923-24165945 ATATGAGAGCAGAAAAAGTGTGG + Intronic
903968143 1:27102346-27102368 GTGTGGGAGCAGAAGCTGCCTGG + Intronic
904066365 1:27754945-27754967 ATGTGAGAGAAGATGCTGCAGGG + Intronic
904648316 1:31985332-31985354 ATGTGGCAGCAGAGGGAGCGGGG + Intergenic
905226423 1:36482033-36482055 AGGTGAGAGTAGAAACAGCAAGG - Intronic
906683914 1:47750393-47750415 CTGTCAGAGCAGAAGCTGCAAGG - Intergenic
907774106 1:57496224-57496246 GTGTGAGTGCAGAGGCAGGGTGG - Intronic
908724154 1:67157091-67157113 GAGAGAGAGCAGAAGCAGGGTGG - Intronic
908903776 1:68985231-68985253 GTGGGAGAGCAGAAGCAGGGTGG + Intergenic
910116780 1:83739998-83740020 ATGCGAGGGTAGAAGCAGAGAGG - Intergenic
911477087 1:98386992-98387014 AGGTGAGCGAAGAAGCAGGGAGG + Intergenic
912546015 1:110452472-110452494 CGGTGAGGGCAGGAGCAGCGTGG + Intronic
913507134 1:119527158-119527180 ATGAGTGAGCAGAAGCAGGGTGG - Intergenic
913942268 1:125119618-125119640 ATGGGAGAGAAGAAGGAGAGCGG + Intergenic
913979947 1:143498815-143498837 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
914074296 1:144324299-144324321 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
914104880 1:144642147-144642169 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
917006978 1:170426318-170426340 ATGGGTGAGCAGAAGCAGGGTGG + Intergenic
917172057 1:172187637-172187659 ATGTGACAGCAGATGCATGGAGG + Intronic
917958593 1:180125167-180125189 AGGTGTGAGCAGAAGCAGAAAGG + Intergenic
919755641 1:201064419-201064441 CTCTGAGAGAAGCAGCAGCGTGG - Intronic
920318228 1:205095618-205095640 ATGTGAGAGCAGAAAGAGAATGG + Intronic
922396719 1:225209845-225209867 AAGGGCGAGCAGAAGCAGGGTGG + Intronic
923146529 1:231202439-231202461 AGGTGAGAGCAGAATGAGCAAGG + Intronic
1064102231 10:12473703-12473725 GTGTGAGAGCAGCAGCTGGGCGG - Intronic
1065590777 10:27259149-27259171 AGGCGAGAGCAGCAGCGGCGGGG - Intergenic
1066954142 10:42149497-42149519 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1069341975 10:67421417-67421439 ATGTTAGAGCAGATGCAGTTTGG - Intronic
1069580336 10:69561584-69561606 ATGCAAGAGCAGAAGAAGGGGGG + Intergenic
1071292627 10:84198406-84198428 ATGTGAGAGAAAAGGCAGTGAGG - Intronic
1072404324 10:95136032-95136054 GAGGGAGAGCAGAAGCAGGGTGG + Intergenic
1073142893 10:101260912-101260934 CTGAGAGAGAAGGAGCAGCGTGG - Intergenic
1075495277 10:122914440-122914462 AACTGGGAGCAGAAGAAGCGAGG - Intergenic
1077485001 11:2834597-2834619 CTGTGCGAGCAGAGGCAGGGAGG + Intronic
1079706222 11:23622719-23622741 AAGAGAGAGCAAAAGCAGAGAGG + Intergenic
1080916173 11:36662538-36662560 GTTTGGGAGCAGAAGCAGCGAGG + Intergenic
1081036337 11:38150883-38150905 ATGTGGGAGGAGAAGCCTCGTGG + Intergenic
1081994769 11:47356308-47356330 ATGTGTAAGCAGATGCAGTGTGG - Intronic
1082670624 11:56032970-56032992 GTGGGTGAGCAGAAGCAGGGTGG + Intergenic
1083300001 11:61735273-61735295 AATTGAGGGCAGAAGCAGGGAGG + Intronic
1083346588 11:61997652-61997674 AGATGAGAGCAGAAGCTCCGTGG + Intergenic
1083673417 11:64312672-64312694 AGGTGAGTGCATATGCAGCGTGG + Intronic
1085745217 11:79109335-79109357 CTGTGAGGGCAGAGGCAGCCAGG + Intronic
1086926747 11:92648940-92648962 AAGGGAGAGCAGAAGGAGAGGGG - Intronic
1088133435 11:106524218-106524240 ATGTGAAATCAGAAGCTGAGAGG - Intergenic
1088299440 11:108340566-108340588 ATGTGACTGCAGAAGTAGGGTGG - Intronic
1088355730 11:108942071-108942093 ATGTGAGAGCAGAGGGACAGTGG - Intergenic
1088648683 11:111938165-111938187 ATGTGAGAGCAGAGGAACTGGGG + Intronic
1089747137 11:120625325-120625347 AGGTCAGAGCAAAGGCAGCGGGG + Intronic
1091667074 12:2426877-2426899 GTGTGAGAGGAGAAGCTGCAAGG + Intronic
1092864938 12:12751884-12751906 ATGTGACGGCAGAAGCAGATTGG + Intronic
1093725840 12:22507294-22507316 AAGTGAGAGGATAAGCAGTGTGG + Intronic
1093773714 12:23047964-23047986 ATGTGAGAGAAGAATCAGAGTGG + Intergenic
1096007870 12:48186479-48186501 ATTTGAGAGCAGAATGAGCTAGG + Intergenic
1098706810 12:73702165-73702187 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
1101274028 12:103179534-103179556 ATGTGAGAACAGAAAAAGAGGGG + Intergenic
1101460301 12:104884313-104884335 GTGTGTGAGCCGAAGCAGGGTGG - Intronic
1103237232 12:119383559-119383581 GTGCGAGAGCAGAAGGAGCCAGG + Intronic
1108712257 13:53045067-53045089 ATGACAGAGCAGAAGCTGCAAGG + Intronic
1112232346 13:97602014-97602036 AAGGGAGAGCTGAAGCAGGGTGG + Intergenic
1112294780 13:98177086-98177108 CGGAGAGAGCAGCAGCAGCGGGG - Exonic
1112381699 13:98896988-98897010 ATGTGAGGCCAGAGGCAGAGTGG + Intronic
1113910886 13:113840721-113840743 CTGGCAGAGCAGAAGCAGCTCGG + Intronic
1114695561 14:24624010-24624032 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1115202547 14:30870336-30870358 ATTATAGAGCAGAAGCAGCTTGG - Intergenic
1117782163 14:59244401-59244423 ATGTGAGAAAAGAAACAGCATGG - Intronic
1118377781 14:65191865-65191887 AGGTGAGAGCGGAAGCAGAGGGG + Intergenic
1118780289 14:69003452-69003474 ATGGGAGAGCAGGAGGAGTGAGG - Intergenic
1118956496 14:70487915-70487937 ATGTGAAAGCAGGAGCAGAGGGG + Intergenic
1119577169 14:75735352-75735374 CTGTGGGAGCAGAAGCACTGTGG + Intronic
1121692131 14:95885550-95885572 AAGTGTGAGCAGAAGCACAGAGG + Intergenic
1121710016 14:96030732-96030754 CTCTGAGACCAGGAGCAGCGAGG - Intergenic
1121737555 14:96228937-96228959 ATGGGAAAGCAGAGTCAGCGAGG - Intronic
1121885225 14:97536656-97536678 CTGGGAGAGGAGGAGCAGCGAGG - Intergenic
1121981935 14:98461949-98461971 ATTTGAGAGGATAAGCAGTGTGG + Intergenic
1202939850 14_KI270725v1_random:136513-136535 ATGGGAGAGAAGAAGGAGGGTGG - Intergenic
1123393274 15:19899364-19899386 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
1124135465 15:27031858-27031880 AAGTGACAGCTGAAGCACCGTGG + Intronic
1124721575 15:32115354-32115376 ATGTGGGAGGAGAAGCAGGCAGG + Intronic
1125280996 15:38042656-38042678 ATGGGAGAGGAGGAGCAGTGGGG + Intergenic
1125575367 15:40751799-40751821 ATGAGAGTCCAGAAGCAGCAAGG + Intronic
1125681086 15:41530578-41530600 ATGCCAGACCAGAAGCAGAGAGG - Intronic
1127662087 15:61109470-61109492 ATGTGATAACAGAGGCAGTGAGG - Intronic
1127930975 15:63597372-63597394 ATGTGAGTGCAGCTGCAGCCGGG - Exonic
1128052445 15:64675891-64675913 AGCTTAGAGCAGCAGCAGCGGGG + Exonic
1129320097 15:74769953-74769975 AAGTGAAAGCAGAAGCAAGGGGG - Intergenic
1130838184 15:87672434-87672456 ATGGGATAGCAGAAGCACAGTGG - Intergenic
1132906610 16:2285768-2285790 ATGGGAGAGCACAAGCACCATGG + Intronic
1134868469 16:17630154-17630176 ATGTGTGGGCAGAGGCATCGAGG - Intergenic
1136186166 16:28590224-28590246 AAGTGAGGGCAGCAGCTGCGAGG + Exonic
1136286860 16:29249212-29249234 ATGGGACAGCAGAGGCAGAGTGG - Intergenic
1136318031 16:29465591-29465613 AAGTGAGGGCAGCAGCTGCGAGG - Exonic
1136432606 16:30204940-30204962 AAGTGAGGGCAGCAGCTGCGAGG - Exonic
1136696271 16:32084465-32084487 ATGGGAGAGAAGAAGGAGAGCGG - Intergenic
1136771626 16:32846141-32846163 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1136796766 16:33027717-33027739 ATGGGAGAGAAGAAGGAGAGCGG - Intergenic
1136867922 16:33771061-33771083 ATGTGAGAGAAGAAGGAGGGCGG + Intergenic
1136957675 16:34803922-34803944 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
1137377764 16:47968394-47968416 ATGATAGAGCTGAAGCAGAGTGG + Intergenic
1138287646 16:55822467-55822489 ATGTGGCAGCAGAAGCTGAGTGG + Intronic
1138421407 16:56901692-56901714 AAGTGAGACCAGAAGCTGCTGGG - Intronic
1141416990 16:83883310-83883332 GTGTGAGAGAAGAACCAGCAGGG - Intergenic
1203074052 16_KI270728v1_random:1108252-1108274 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1203104255 16_KI270728v1_random:1345217-1345239 ATGTGAGAGAAGAAGGAGGGCGG - Intergenic
1203129259 16_KI270728v1_random:1617151-1617173 ATGTGAGAGAAGAAGGAGGGCGG + Intergenic
1143427225 17:6849497-6849519 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1143724389 17:8835455-8835477 CTCTGAGGGCAGAAGCAGAGGGG + Exonic
1143964254 17:10745347-10745369 ATGTGTGGACAGAAGCAGGGGGG - Intergenic
1144712053 17:17407724-17407746 ATGTGTGAGCAGAAGAGGCCAGG - Intergenic
1145042035 17:19584173-19584195 TTGTGACAGCAGAAGCCACGGGG + Intergenic
1145690207 17:26731759-26731781 ATGGGAGAGAAGAAGGAGAGCGG + Intergenic
1145765635 17:27456674-27456696 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
1148686722 17:49505244-49505266 ATGTGGAAGCAGAAGCAGAAAGG - Intronic
1149342117 17:55698011-55698033 ACGTGAGAGGAGCAGCAGCCAGG - Intergenic
1149523432 17:57335847-57335869 ATGTGTGAGGAGTAGCAGGGAGG + Intronic
1150490481 17:65570943-65570965 ATGTGATAGCAAAATTAGCGGGG + Intronic
1150979236 17:70122998-70123020 ATTTAAGAGCAGAAGGAGGGAGG - Intronic
1152645724 17:81467722-81467744 ATGTGGCAGCAGGATCAGCGGGG + Intergenic
1153008343 18:515414-515436 AGGGGAGAGCAGAAGCGGAGTGG - Intergenic
1153010245 18:532172-532194 TTGGCACAGCAGAAGCAGCGTGG + Intergenic
1153136704 18:1925743-1925765 ATGTGAGAACAGAAGGAGTTTGG - Intergenic
1153717933 18:7869491-7869513 GAGGGAGAGCAGAAGCAGGGTGG - Intronic
1154518294 18:15197723-15197745 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1155774738 18:29746393-29746415 ATATGAGAGAGGAGGCAGCGAGG - Intergenic
1156351147 18:36302264-36302286 ATGGGATAGCTGAGGCAGCGAGG - Intronic
1157406434 18:47425770-47425792 ATGAGAGAGGGGAAGCAGGGAGG - Intergenic
1157743051 18:50110146-50110168 ATTTGAGGGAGGAAGCAGCGTGG - Intronic
1159644637 18:70903031-70903053 GGGAAAGAGCAGAAGCAGCGAGG + Intergenic
1159901685 18:74053098-74053120 GAGGGTGAGCAGAAGCAGCGTGG + Intergenic
1161242408 19:3229645-3229667 AGGTGAGAGCAGAAGTGGCAGGG + Intronic
1161578235 19:5066583-5066605 ATGTGCAAGCCAAAGCAGCGTGG - Intronic
1163568127 19:18063916-18063938 AGGTGCGAGCAGACACAGCGTGG - Exonic
1163784261 19:19266549-19266571 AGGTGAGAGCATAGGCAGCCAGG + Exonic
1164598498 19:29545997-29546019 AGGTGAGAGCTGATGCAGTGAGG + Intronic
1165488248 19:36108359-36108381 ATGTGGGGGTAGAAGCAGGGGGG - Intergenic
1166560724 19:43730919-43730941 AAGTGAGAGCAGAAGACACGAGG + Exonic
1166898604 19:46040497-46040519 AGGTGAGAACAGATGCAGTGAGG - Exonic
1167707702 19:51091398-51091420 ACATGAGATCAGAAGCAGAGAGG - Intergenic
1167981460 19:53279771-53279793 ATGTGAGTACAGGAGCTGCGGGG + Intergenic
1168584773 19:57583590-57583612 AGGTCAGAGCAGGAGCAGCCGGG + Intronic
1168608318 19:57777601-57777623 ATGTAACAGCAGAAGCAACAAGG - Intronic
1202669858 1_KI270709v1_random:40421-40443 ATGGGAGAGGAGAAGGAGAGCGG + Intergenic
1202680197 1_KI270712v1_random:2656-2678 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
925371348 2:3347945-3347967 AGGAAAGAGCAGGAGCAGCGGGG + Intronic
925929084 2:8693442-8693464 GTGAGAGAGCAGCCGCAGCGGGG + Intergenic
926761714 2:16284121-16284143 ATGTGGGAGGAGAGGCAGAGGGG - Intergenic
927277408 2:21273616-21273638 CTGTCAGAGCAGACGCAGCCAGG - Intergenic
928259333 2:29752720-29752742 ATGTGAGAGCAGAAACAACAGGG - Intronic
929089191 2:38197928-38197950 ATGTGAGGGCTGAGGCAGAGTGG - Intergenic
929850259 2:45581243-45581265 ATGTGAGAGCATAAGGAGGTAGG - Intronic
931212171 2:60207609-60207631 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
932074014 2:68646305-68646327 AGGTGAGTGCAGCAGCAGTGGGG + Exonic
932739543 2:74281234-74281256 AGTTGAGACCAGAAGCAGCTTGG + Intronic
936008605 2:108910677-108910699 ATGTGAGAGCAGAAGCAGCGAGG + Intronic
937661245 2:124432112-124432134 ATGTGATAGCAAAAACAGAGGGG + Intronic
938498110 2:131814159-131814181 ATCTGAGTATAGAAGCAGCGAGG + Intergenic
938518206 2:132037953-132037975 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
939637464 2:144599883-144599905 ATGTGAGAGAATATGCAGCAAGG - Intergenic
940054624 2:149500507-149500529 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
940400633 2:153244499-153244521 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
940834465 2:158505624-158505646 AGGTGAGAAAAGAAGCAGGGTGG + Intronic
941477963 2:165971643-165971665 GAGGGAGAGCAGAAGCAGGGTGG + Intergenic
942834668 2:180279343-180279365 ATGTAAGAGCAGATACAGAGAGG - Intergenic
943187759 2:184634524-184634546 ATGTGATGACAGAAGCAGAGGGG + Intronic
943587608 2:189759568-189759590 ATGTGAAAACAGAATCAGAGAGG + Intronic
946305615 2:218855505-218855527 AAGTGAGAGCTGAAGCAGCAGGG + Intergenic
947220417 2:227786394-227786416 GTGATGGAGCAGAAGCAGCGTGG + Intergenic
948077737 2:235179444-235179466 GTGTGAGAGAAGACGCAGTGTGG + Intergenic
1168896256 20:1325734-1325756 AAGGGAGAGCAAAAGCAGCCGGG - Intronic
1169065120 20:2690829-2690851 GTCTGAGAGCAGAAGCAGGAAGG + Intergenic
1169484291 20:6013628-6013650 AGGTGAGAGCAGAGACAGTGTGG + Intronic
1171331171 20:24340017-24340039 ATTTGAGTGCAGAAGCAGACTGG - Intergenic
1172027039 20:31955579-31955601 TTGTGTGAGCAGCAGCAGGGAGG - Intergenic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1175856800 20:62125219-62125241 CTGTGAGAGCAGCAACAGCCTGG - Intronic
1176583339 21:8550572-8550594 ATGGGAGAGAAGAAGGAGGGTGG + Intergenic
1177042787 21:16133485-16133507 GTGGGTGAGCAGAAGCAGGGTGG - Intergenic
1178141473 21:29688917-29688939 ATGTGAGAGTACAGGCAGTGAGG + Intronic
1179126501 21:38595587-38595609 ACCTCAGAGCAGAAGCAGGGCGG + Intronic
1179409367 21:41150257-41150279 GTGTGAGAGCAGATGCAATGCGG + Intergenic
1180266149 22:10527502-10527524 ATGGGAGAGAAGAAGGAGGGTGG + Intergenic
1180997409 22:19972337-19972359 AGGTGAGTGCAGATGCAGTGTGG - Exonic
1182204262 22:28607881-28607903 GAGTGAAAGCAGAAGCAGGGAGG - Intronic
1182451732 22:30425880-30425902 ATGTCAGAGCCGCAGCCGCGGGG + Exonic
1182829734 22:33295274-33295296 ATGTGTGATGAGAAGCAGCAGGG + Intronic
1183786883 22:40034480-40034502 CTGGGAGAGCAGAAGCTGCAAGG - Exonic
1184145644 22:42608640-42608662 AAGGGTGAGCACAAGCAGCGAGG + Intronic
1184296914 22:43530683-43530705 AAGTGAGATCTGAAGCAGCCAGG + Intronic
1184982841 22:48106484-48106506 ATGTCAGAGCCGAGGCAGAGTGG - Intergenic
1203324981 22_KI270738v1_random:4868-4890 ATGGGAGAGAAGAAGGAGAGTGG - Intergenic
949117997 3:351824-351846 ATGTATGAGCAAAAGCAGCCAGG + Intronic
949934081 3:9102915-9102937 ATGTGACAGCAGCAGCAGGCGGG + Intronic
951629196 3:24699764-24699786 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
951699909 3:25485812-25485834 GTGTGAGAGGAGCAGCAGCCAGG - Intronic
952608152 3:35174102-35174124 AAGAGTGAGCAGAAGCAGGGTGG - Intergenic
953007814 3:38994538-38994560 ATATGAGGGCAGAAGTAGGGAGG - Intergenic
956751550 3:72347775-72347797 AGTTGAGGGCAGAAGCAGCATGG + Intergenic
958124942 3:89343662-89343684 ATATGAGACCAGAAGCAAAGTGG - Intronic
959391967 3:105786440-105786462 GTTTGAAAGCCGAAGCAGCGTGG - Intronic
961411067 3:126720755-126720777 AAGTGACAGCAGGAGCAACGTGG - Intronic
961583830 3:127905504-127905526 TGGTGAGTGCAGAAGCAGGGAGG + Intergenic
961711068 3:128828625-128828647 AGGTGAGATCAGATCCAGCGTGG + Intergenic
962724648 3:138211630-138211652 ATGGTAGAGTAGAAGGAGCGTGG + Intronic
962754377 3:138456989-138457011 ATGGGAGAGCAGAGGGAGGGGGG - Intronic
965694057 3:171388584-171388606 ATGTGAGTGCTGAAGCAGTAGGG - Intronic
966188518 3:177249442-177249464 AGGTGTGAGCAGAAGCAACACGG - Intergenic
966985872 3:185179858-185179880 ATGTGAGCACAGATGCAGGGAGG + Intergenic
967715503 3:192757902-192757924 GAGGGAGAGCAGAAGCAGGGTGG + Intronic
967814974 3:193790783-193790805 AAGGGTGAGCAGCAGCAGCGTGG + Intergenic
970397362 4:15682020-15682042 AGGTGAGAGCAGAAGCAATCCGG + Intronic
970455526 4:16219996-16220018 CTGGCAGAGCAGAAGCAGCGAGG - Intronic
973752517 4:54036456-54036478 ATGGCAGAGCAGGAGCAACGGGG + Intronic
975213047 4:71722968-71722990 GAGAGAGAGCAGAAGCAGGGTGG - Intergenic
976519108 4:86006018-86006040 ATAAGAGAGTAGAAGCCGCGTGG - Intergenic
977473225 4:97469514-97469536 GTGAGAGAGCAGAATCAGAGAGG + Intronic
977753179 4:100633877-100633899 ATGTCACAGCTGAAGCAGAGAGG + Intronic
978502558 4:109424632-109424654 TTGTGATAGCTGAAGCAGAGAGG - Intergenic
980382706 4:132045254-132045276 ATGTCACAGCTGAAGCAGTGAGG + Intergenic
981501564 4:145457684-145457706 AAGTGTGAGCGGAAGCAGGGCGG + Intergenic
981676112 4:147344945-147344967 GTGTGAGAGCAGAAGCTGCAAGG - Intergenic
982957959 4:161794377-161794399 ATGTGAGTGAAGAAGCAACTAGG - Intronic
983596390 4:169472430-169472452 GAGGGAGAGCAGAAGCAGGGTGG - Intronic
984617533 4:181915638-181915660 AGGAGAGAGGAGAAGCAGAGAGG + Intergenic
984651148 4:182271887-182271909 CTGTGAGAGCAGGTGCAGCAGGG + Intronic
985723041 5:1500834-1500856 GTGTGAGAGCAGCAGCAATGAGG - Intronic
986188583 5:5470316-5470338 AAGTGAGAGCAGAAGCAGGCTGG - Intronic
986572463 5:9179805-9179827 CTGTAAGAGCAGATGCAGTGTGG + Intronic
986696888 5:10365104-10365126 CTGTGAGATCAGAAGAAGCAGGG - Intronic
987220360 5:15784669-15784691 TGGTGAGAGCAGGAGCAGGGGGG - Intronic
990288912 5:54329009-54329031 ATGTGACAGCAGAGGCAGAGTGG - Intergenic
990863402 5:60353299-60353321 AGCTGAGAGCAGTAGCAGTGGGG - Intronic
990944787 5:61238556-61238578 ATGGCAAAGCAGAAGCAGCATGG - Intergenic
991409588 5:66332936-66332958 AAGGGAGAACAGAAGCAGTGAGG - Intergenic
992157989 5:73973440-73973462 ATGTGACAACAAAAGCAGAGAGG + Intergenic
993402602 5:87472475-87472497 AAGGGCGAGCAGAAGCAGGGCGG + Intergenic
995790742 5:115883499-115883521 AAGGGTGAGCAGAAGCAGGGTGG - Intronic
996249950 5:121317362-121317384 ATGTGCTAGCAGCAGCAGCAAGG + Intergenic
998387267 5:141764675-141764697 ATGAGAAAACAGAAGCAGAGAGG - Intergenic
998858469 5:146419381-146419403 AGATGAGAGCAGTGGCAGCGAGG + Intergenic
999367990 5:151035300-151035322 ATGTTAGCAGAGAAGCAGCGAGG - Intronic
999586230 5:153092688-153092710 CTGTGAGAGCAGAGGGAGCCAGG - Intergenic
999622147 5:153484589-153484611 AAGTGAGAGCAAAAGCAATGCGG + Intergenic
1000052024 5:157571682-157571704 GAGTGAGAGCAGAAGCAGGAAGG + Intronic
1000583069 5:163057367-163057389 ATGCAAGAGCAGAAGCAATGGGG - Intergenic
1001022466 5:168195097-168195119 ATGAGGGAGCAGAGGCAGTGGGG + Intronic
1004157640 6:13184265-13184287 ATTTGAGAGCAGAGACAGAGCGG + Intronic
1007629413 6:43264563-43264585 AAGTGAGGGCAGAAGCTGAGAGG + Intronic
1008157261 6:48031585-48031607 ATGTGAGAATAGAAGCCGTGGGG + Intronic
1009570095 6:65374233-65374255 AAGGGTGAGCAGAAGCAGGGTGG + Intronic
1010668392 6:78656100-78656122 GAGGGCGAGCAGAAGCAGCGTGG - Intergenic
1012840827 6:104326946-104326968 GTGTGAGAGGAGCAGCAGGGAGG - Intergenic
1013939506 6:115644994-115645016 GAGTGCGAGCAGAAGCAGGGTGG + Intergenic
1016507009 6:144793866-144793888 ATGTGTGACCAGAGGCAGCTGGG + Exonic
1017033623 6:150247234-150247256 ATCTGAGAGCAAAAACACCGAGG - Intronic
1017644323 6:156525102-156525124 ATGAGAAAGCAGAATCAGGGAGG - Intergenic
1019021767 6:168924565-168924587 GGGTGAGAGCAGGAGCAGAGTGG - Intergenic
1019317010 7:391484-391506 CTGTGTGTGCAGAAGCAGCCAGG + Intergenic
1021434557 7:20599535-20599557 ATCTGAAATCAGAAGCAACGAGG - Intergenic
1022383849 7:29884279-29884301 AGGTGGGAGCAGAGGGAGCGGGG - Exonic
1022647110 7:32241879-32241901 ATGTGAGTGCAGATGCAGGGAGG + Intronic
1023138155 7:37074713-37074735 ATATTAGACCAGAAGCAGCTAGG + Intronic
1025320381 7:58088080-58088102 ATGGGAGAGAAGAAGGAGAGCGG + Intergenic
1025840385 7:65141208-65141230 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
1025878329 7:65508956-65508978 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1025882672 7:65554756-65554778 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1025890771 7:65647847-65647869 ATGGGAGAGAAGAAGGAGGGCGG + Exonic
1030334233 7:108307190-108307212 ATGTGAGCGAAGCAGCAGCCGGG + Intronic
1031170879 7:118290794-118290816 CTGTTAGAGCTGAAGCAGCTGGG - Intergenic
1033153056 7:138933240-138933262 ATGAGAGAGAAGAATCACCGAGG + Intronic
1034348356 7:150400683-150400705 ATGTGACAGTAGAAGCAGCTTGG - Intronic
1034520303 7:151614311-151614333 ATGGGGGAGCAGCAGCAGGGTGG + Intronic
1037006150 8:13783147-13783169 ATAAGAGAGTAGAAGCAGCTAGG - Intergenic
1037033268 8:14136322-14136344 AAGTGTGAGCCGAAGCAGGGTGG + Intronic
1039984515 8:42436426-42436448 ATGTGAGAGAAGAAGGAAAGAGG - Intronic
1040451759 8:47554715-47554737 AAGTGTGAGCCGAAGCAGGGTGG - Intronic
1040772355 8:50992447-50992469 GTGTGTGAGCCGAAGCAGGGTGG - Intergenic
1042338965 8:67658877-67658899 ATGAGAGAGGAGCAGCAGAGGGG - Intronic
1043091369 8:75908303-75908325 GTGTGAGAGCAGAAGAAAAGTGG + Intergenic
1044712833 8:95073515-95073537 ATGGGGGAGGAGGAGCAGCGGGG - Intronic
1045152948 8:99429705-99429727 AAGAGACAGCAGAAGCAACGAGG - Intronic
1046190167 8:110784822-110784844 TGGTGAGAGAAGAAGCAGGGAGG + Intergenic
1047249187 8:123168950-123168972 AGGTGAGAGTCGAAGCAGGGAGG - Intergenic
1048332802 8:133482547-133482569 AAGTGAAAGCAGATGCAGTGGGG - Intronic
1049214829 8:141402735-141402757 ATGAGAAAGCGGAAGCAGGGGGG - Intronic
1050750698 9:8933163-8933185 AAGGGCGAGCAGAAGCAGGGTGG - Intronic
1053002038 9:34582350-34582372 CTCAGAGAGCAGAAGCAGCTTGG + Intronic
1053523841 9:38808962-38808984 AGATGAGAGCTGAAGCAGAGAGG - Intergenic
1054886539 9:70204899-70204921 ATGCGCGAGCTGAAGCAGGGCGG - Intronic
1055030802 9:71769657-71769679 CTGTGAGAGCAGCTCCAGCGAGG - Intronic
1055810959 9:80147283-80147305 GTATGAGAGCAGAAGCTGCCAGG + Intergenic
1057220648 9:93256151-93256173 ACATGACAGCAGAAGCAGTGAGG - Intronic
1057384200 9:94593077-94593099 ATGAGAGAGCAGATGCAGGAAGG + Intronic
1058182436 9:101815365-101815387 GAGGGTGAGCAGAAGCAGCGTGG + Intergenic
1058935718 9:109767639-109767661 ATGTCAGGGCAGAGGGAGCGAGG - Intronic
1059914484 9:119084005-119084027 ATGTGAGAGAAGAGGCAACTGGG + Intergenic
1059984878 9:119812172-119812194 GTGTGAGGGCAGAGGCAGGGAGG + Intergenic
1060348388 9:122836746-122836768 TGGTGAGAGCAGAAGCAAGGTGG + Intergenic
1061258498 9:129466510-129466532 AGGGCAGAGCAGAAGCAGGGAGG + Intergenic
1061984402 9:134121550-134121572 ATGGGAAAGCAGAAGCAAGGTGG + Intergenic
1203613294 Un_KI270749v1:28339-28361 ATGGGAGAGAAGAAGGAGGGTGG + Intergenic
1186432493 X:9517053-9517075 CTGGGAGAGCAGAAGAAACGTGG + Intronic
1186466059 X:9785780-9785802 AGGTGAGAGCGGAAGCGCCGCGG - Intronic
1186828120 X:13362197-13362219 ATGTGAGAGAAGCAGAAGAGAGG - Intergenic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1191043969 X:56116107-56116129 ATTTTAGAGCAGAAGCAGTCTGG - Intergenic
1193384353 X:80853057-80853079 AAGGGAGAGCTGAAGCAGCAAGG + Intergenic
1194783209 X:98049651-98049673 AAGGGCGAGCAGAAGCAGAGTGG - Intergenic
1195070357 X:101273229-101273251 AGGTGAGAGTAGAAGCAAAGAGG - Intronic
1196367891 X:114943465-114943487 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1197952255 X:131910207-131910229 ATGTGACAGAAGAAGCAGATTGG - Intergenic
1201563660 Y:15344161-15344183 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic