ID: 936008939

View in Genome Browser
Species Human (GRCh38)
Location 2:108912465-108912487
Sequence GGTCCCAGGACACCCATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936008932_936008939 -5 Left 936008932 2:108912447-108912469 CCACCAGCACCTCCCAGCGGTCC 0: 1
1: 0
2: 2
3: 37
4: 386
Right 936008939 2:108912465-108912487 GGTCCCAGGACACCCATAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
936008926_936008939 7 Left 936008926 2:108912435-108912457 CCCCCGCCTTCACCACCAGCACC 0: 1
1: 0
2: 19
3: 930
4: 5757
Right 936008939 2:108912465-108912487 GGTCCCAGGACACCCATAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
936008930_936008939 1 Left 936008930 2:108912441-108912463 CCTTCACCACCAGCACCTCCCAG 0: 1
1: 0
2: 12
3: 132
4: 1146
Right 936008939 2:108912465-108912487 GGTCCCAGGACACCCATAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
936008923_936008939 22 Left 936008923 2:108912420-108912442 CCACCTGCCGCTATGCCCCCGCC 0: 1
1: 0
2: 1
3: 13
4: 266
Right 936008939 2:108912465-108912487 GGTCCCAGGACACCCATAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
936008925_936008939 15 Left 936008925 2:108912427-108912449 CCGCTATGCCCCCGCCTTCACCA 0: 1
1: 0
2: 0
3: 15
4: 264
Right 936008939 2:108912465-108912487 GGTCCCAGGACACCCATAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
936008927_936008939 6 Left 936008927 2:108912436-108912458 CCCCGCCTTCACCACCAGCACCT 0: 1
1: 0
2: 2
3: 38
4: 573
Right 936008939 2:108912465-108912487 GGTCCCAGGACACCCATAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
936008933_936008939 -8 Left 936008933 2:108912450-108912472 CCAGCACCTCCCAGCGGTCCCAG 0: 1
1: 0
2: 0
3: 31
4: 400
Right 936008939 2:108912465-108912487 GGTCCCAGGACACCCATAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
936008928_936008939 5 Left 936008928 2:108912437-108912459 CCCGCCTTCACCACCAGCACCTC 0: 1
1: 1
2: 6
3: 77
4: 715
Right 936008939 2:108912465-108912487 GGTCCCAGGACACCCATAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
936008924_936008939 19 Left 936008924 2:108912423-108912445 CCTGCCGCTATGCCCCCGCCTTC 0: 2
1: 0
2: 1
3: 6
4: 132
Right 936008939 2:108912465-108912487 GGTCCCAGGACACCCATAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
936008929_936008939 4 Left 936008929 2:108912438-108912460 CCGCCTTCACCACCAGCACCTCC 0: 1
1: 1
2: 137
3: 1148
4: 6254
Right 936008939 2:108912465-108912487 GGTCCCAGGACACCCATAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936008939 Original CRISPR GGTCCCAGGACACCCATAGA GGG Intronic
900498363 1:2987233-2987255 GGTGCCAGGCCACACATGGATGG + Intergenic
901880703 1:12192130-12192152 GGAACCAGGAGACCCAGAGATGG + Intronic
903385549 1:22924034-22924056 GGCCCCAGGACACCTAAGGAAGG - Intergenic
905355708 1:37382772-37382794 GGGCCCAGGAGACATATAGAAGG + Intergenic
905513782 1:38545641-38545663 GGTCCCAGAAAACCCAGAAAAGG + Intergenic
908429958 1:64046741-64046763 GGTACCATGAGACCCATTGAGGG - Intronic
910863307 1:91764492-91764514 GCTCCCAGGACCCCTTTAGAAGG - Intronic
912436436 1:109665249-109665271 GGTCCCAGGATAGGCAGAGATGG - Intronic
918071666 1:181137697-181137719 AGTCTCAGGACAGCCACAGAAGG - Intergenic
919253950 1:195097009-195097031 GCTCTCAGGAGACCCATAGAGGG - Intergenic
920508153 1:206531556-206531578 GCTCCAAGAACACCCAGAGAGGG - Intronic
921131234 1:212221743-212221765 GGGCCCAGGACAGCCTGAGAAGG - Intergenic
1063887582 10:10595333-10595355 GGTCCCAGCACAGCCTTACAGGG - Intergenic
1064337367 10:14456180-14456202 GTTCACAGGACACCCCTGGAGGG - Intronic
1065129933 10:22610270-22610292 GGTCCCAGGACTACAAGAGAAGG + Intronic
1066505071 10:36033260-36033282 GATCCCAGGAGAGGCATAGATGG + Intergenic
1067106633 10:43371064-43371086 GGTCCCAGAACCCCCAAAGCTGG + Intergenic
1068569040 10:58608116-58608138 GGGCCCAGAACACCCACAAAGGG - Intronic
1071886051 10:89951807-89951829 GGTCCATGGGCACCCATGGAAGG + Intergenic
1076133186 10:128027889-128027911 AGTCCCAGGACACCCACAGGAGG + Intronic
1077158675 11:1102855-1102877 GGGCCCAGGACACACCTGGAGGG - Intergenic
1077239975 11:1505526-1505548 GGTTCCAGGACCCCCAAAAATGG + Intergenic
1079910011 11:26298259-26298281 GATCCCAGGGCACCCACAAAGGG + Intergenic
1083793950 11:65003771-65003793 GGGCACAGGACACCCTTAGACGG + Intergenic
1083995016 11:66267494-66267516 GGTCCCAGGACCCCCTTGGGAGG - Exonic
1084417923 11:69044178-69044200 GGGCCCAGAACACCCACAAACGG + Intergenic
1084930802 11:72554077-72554099 GGTCACAGGACATAGATAGATGG - Intergenic
1089848854 11:121479983-121480005 GTCCCCAGGACTCCCAGAGAGGG + Intronic
1090912935 11:131137102-131137124 GGTCCTAGGACTCTAATAGATGG + Intergenic
1093502392 12:19827803-19827825 GCTCTCAGGAGACCCAAAGAGGG + Intergenic
1098519609 12:71420782-71420804 GCTCTCAGGACACCCACAGTGGG + Intronic
1098671422 12:73235294-73235316 GGTCCATGGACAGCCATAGGCGG + Intergenic
1100164112 12:91896741-91896763 GTTTCCAGGTCACCCATAAAAGG + Intergenic
1101464908 12:104938621-104938643 GGTCCCAAGACAACGACAGATGG + Intronic
1103733311 12:123042819-123042841 GGTCCCTGGATACACATAGATGG - Intronic
1103791855 12:123477785-123477807 TTTGCCAGGACACCCAAAGAGGG + Intronic
1104694610 12:130853681-130853703 GGTCCCAGGTTGCCCCTAGATGG - Intergenic
1107898892 13:44992672-44992694 GGTGCCAGGATACCCTTACAGGG - Intronic
1113698722 13:112366865-112366887 GTTCCCATGCCACCCAAAGAGGG - Intergenic
1116057873 14:39886035-39886057 GGTACCAGCACAGCCATAGAGGG + Intergenic
1117135486 14:52730638-52730660 GGTCCCGGGACGCCCTTAGGAGG - Intronic
1118458264 14:65964490-65964512 GGTACAAAGACACACATAGAAGG + Intronic
1121439612 14:93940437-93940459 GGTCCCAGGACAGCAAGATAGGG - Intronic
1122787903 14:104172374-104172396 GGACCCAGGACACACGTAGGAGG - Intronic
1122809280 14:104280084-104280106 GGTTCCAGGACATCCACAAAGGG + Intergenic
1122997073 14:105270942-105270964 GCACCCAGGACACCCCTCGAGGG + Intronic
1123412623 15:20072913-20072935 GGTACCAGGCCACCCATGGGTGG + Intergenic
1123521965 15:21080026-21080048 GGTACCAGGCCACCCATGGGTGG + Intergenic
1124782761 15:32651619-32651641 GGTCCCAGTCCATTCATAGATGG - Intronic
1126292563 15:47099151-47099173 GCTCCGAGGAGACCCATAGTGGG + Intergenic
1126420691 15:48469300-48469322 TGTCCCAGGAAACCCTCAGAAGG + Intronic
1127945264 15:63744844-63744866 GGTACCAGCACAGCCATGGAGGG - Intronic
1128258650 15:66216588-66216610 GGTCCCAGGCAAACCAAAGAAGG + Intronic
1129057792 15:72834217-72834239 GTCCCCAGAACACACATAGAGGG - Intergenic
1130206512 15:81880478-81880500 GGTCCCAGGAGGAGCATAGAAGG - Intergenic
1133071507 16:3249608-3249630 GGTGCCAGGACTCCCATGAAAGG - Exonic
1136633894 16:31507213-31507235 GGTACCATGCCACCCAGAGAGGG - Intronic
1137343952 16:47637186-47637208 GCTCCCAGGAGACCCAAAGTGGG - Intronic
1139138570 16:64233893-64233915 GCTCCAAGGACACCCAAAGTGGG - Intergenic
1139513313 16:67439460-67439482 GGTACAAGCACACCCATGGATGG + Intronic
1140476458 16:75241677-75241699 GGTACCAGGCCACCCATGGGCGG + Intronic
1141700005 16:85638033-85638055 GGGCCCAGGGCACCCAGAGGAGG - Intronic
1142684218 17:1568269-1568291 CTCCCCAGGACACCCAGAGATGG - Intergenic
1145263881 17:21370217-21370239 GATCCCAGGCCACCCATTGCAGG - Intergenic
1145986910 17:29053170-29053192 GGACCCAGGACACCCAGAGCAGG - Intronic
1147596968 17:41723800-41723822 GGTACCAGGACAGCACTAGAGGG + Exonic
1147613361 17:41813920-41813942 GGTTCCAGGAGAACCAGAGAGGG - Intronic
1149298900 17:55286164-55286186 GGTCCAAGGCCAGCCATGGAAGG + Intronic
1150830184 17:68512116-68512138 CGACCCAAGACACCCAGAGAGGG + Intronic
1151562801 17:74879630-74879652 GGTCCCAGGACACCTGGAGTGGG - Intronic
1152025898 17:77809087-77809109 GGCCACAGGACACTCATACAGGG + Intergenic
1152579873 17:81161126-81161148 GGTCCCAGGACACACATCTGGGG - Intronic
1157691160 18:49682894-49682916 GCTCACAGGACACCCATACTGGG - Intergenic
1160729110 19:632700-632722 GGTCCCAGGACACGCCCAGACGG - Intronic
1160761520 19:787767-787789 GGTCTCAGGTCACCCACAGCCGG - Intergenic
1160996345 19:1883822-1883844 GCCCCCAGGACACCCCAAGAGGG - Intronic
1161221087 19:3118597-3118619 GGTCCCTGGGCACCCATCGCAGG + Intronic
1164203376 19:23037817-23037839 TGTCCAAGGCCACCCATATAGGG + Intergenic
1166597021 19:44059074-44059096 GGTCACAGAACACCCAAACAAGG - Intronic
925459583 2:4048945-4048967 GGTCCAAGATCACACATAGATGG - Intergenic
925903070 2:8522508-8522530 GGGCCCAGGAGACCCAAGGAGGG - Intergenic
926804013 2:16687971-16687993 TGTCCCAGGACATTCATAGAAGG + Intergenic
932192764 2:69754801-69754823 GGCCCCAGGACAGCCTTAGGAGG - Intronic
932485323 2:72081046-72081068 GGTCCCTGGACAGCCATGGGTGG - Intergenic
934943299 2:98518292-98518314 GGTCCCTGGGCACCCCTAGTGGG + Intronic
934991279 2:98923428-98923450 GGTCCCAGGACACCCCCTAATGG + Intronic
935299598 2:101682462-101682484 GGTCCCAGGAGACTCAGAGCTGG + Intergenic
936008939 2:108912465-108912487 GGTCCCAGGACACCCATAGAGGG + Intronic
938949349 2:136242759-136242781 TGTGCCAGGTCACCCAGAGATGG - Intergenic
942166297 2:173244076-173244098 GGTCCCAGGACACACTGAAACGG + Intronic
943226775 2:185188018-185188040 GGTACCAGTACAGCCATAGAGGG - Intergenic
946158931 2:217824361-217824383 GCTCACAGGACACCCAGAGCTGG + Intronic
946622293 2:221573063-221573085 GGGCCCAGGACGCCCCGAGATGG + Intronic
946689773 2:222301403-222301425 GGTCCCTGGACACCCGGAGAGGG + Intronic
948567362 2:238895636-238895658 GCTCCCAGGACACTCATCGTGGG + Intronic
948628384 2:239284626-239284648 GGTCCCAGCACACACAGAGCAGG + Intronic
948718589 2:239882078-239882100 TGTCCCAAGACAGCCAGAGAAGG + Intergenic
1170314884 20:15031491-15031513 GCTCTCAGGAAACCCATAGTGGG + Intronic
1171486310 20:25489033-25489055 GGTCCCTGGACACACAGAGGCGG + Intronic
1174362727 20:50038951-50038973 GGTTCCAGGGCACGCATAGGGGG - Intergenic
1178749099 21:35283743-35283765 GGTCCCAGGACACTCCCAGAAGG + Intronic
1180092339 21:45539523-45539545 GGTCCCTGGACCCCCAAAGCTGG - Intronic
1180703514 22:17794634-17794656 GGTCCCTGCACAGCCATAGAAGG - Intronic
1181090511 22:20469344-20469366 GGTCACAGGACACACAGAGCAGG + Intronic
1181465225 22:23107283-23107305 GGTCCCAGGCCAGCGACAGATGG - Intronic
1182419490 22:30241993-30242015 GTGGCCCGGACACCCATAGACGG - Exonic
1184455904 22:44609297-44609319 GGTGCCAGGACTCCCTTATAAGG + Intergenic
1184520571 22:44991595-44991617 GGGGCCAGGACATCCATGGAGGG + Intronic
1184992865 22:48182439-48182461 GCTGCCAGGACACGCACAGAGGG - Intergenic
1185063031 22:48616899-48616921 GGAGACTGGACACCCATAGAAGG - Intronic
1185239857 22:49736807-49736829 GGTTCCAGGATCCCCATAGCAGG + Intergenic
953289895 3:41650134-41650156 GCTCCCAGGAGACCCAAAGTGGG - Intronic
953568181 3:44051051-44051073 GACCACAGGACACCCACAGAGGG + Intergenic
958631193 3:96685800-96685822 GGTACCAGCACAGCCACAGAGGG - Intergenic
961438466 3:126935977-126935999 TGGCCCAGGAAATCCATAGATGG + Intronic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
963515310 3:146301334-146301356 GGTGCCAGCACAGCCACAGAGGG + Intergenic
968466458 4:754021-754043 GGTGCCAGGACCACCAAAGACGG - Intronic
968541991 4:1172508-1172530 GCCCCCGGGACACCCAGAGAGGG - Intronic
969902536 4:10363097-10363119 TGTCCCAGGAAACCCAGAGGAGG + Intergenic
974628940 4:64458145-64458167 GCTCTCAGGAGACCCATAGTGGG - Intergenic
977042336 4:92030324-92030346 GGACCCAGGACACCCAATTAGGG - Intergenic
977399114 4:96509660-96509682 GGTACCAGCACATCCATAGCAGG + Intergenic
977955193 4:103018645-103018667 GGCTCTAGGACACCCATAGAGGG + Intronic
983824862 4:172247027-172247049 GGTCTCATTACATCCATAGATGG - Intronic
988966158 5:36420117-36420139 GGCCCCAGCCCACCCACAGATGG + Intergenic
989732525 5:44664994-44665016 GCTCCCTGGACACCCAAAGGGGG - Intergenic
989970750 5:50521374-50521396 GGTACCAGCACAGCCACAGAGGG - Intergenic
991039626 5:62162266-62162288 GCTCTCAGGAGACCCAAAGAGGG + Intergenic
1001889966 5:175330547-175330569 GGCCCCAGGACATCCCCAGAAGG - Intergenic
1002329015 5:178428940-178428962 GGTCTCAGGACACTCACGGAGGG - Intronic
1005730005 6:28687767-28687789 GTCCCCAAGACACCCATAAAGGG + Intergenic
1009272229 6:61627918-61627940 GTTCCCAGGCCACCCATACTTGG - Intergenic
1010324593 6:74550146-74550168 GGTACCAGCACAGCCACAGAGGG - Intergenic
1012356970 6:98326524-98326546 GGTCCCAAGCCACCTATACAAGG + Intergenic
1017058559 6:150459658-150459680 GGTCCCACAAGACCCAGAGAGGG - Intergenic
1018978305 6:168582417-168582439 GGTCCCAGGACAGCAACTGAGGG + Intronic
1019497400 7:1346831-1346853 TCTCCCACGACACCCACAGAGGG - Intergenic
1019747157 7:2707417-2707439 GGGCCCAGGAAACCCGGAGAGGG - Intronic
1024024672 7:45400310-45400332 GCTCTCAGGACACCCAAAGTAGG - Intergenic
1031754371 7:125619082-125619104 GATCCCAGGAGACCAAAAGATGG - Intergenic
1032325809 7:130927191-130927213 GTTCCCAGGGCAGCCACAGATGG - Intergenic
1034450122 7:151132775-151132797 GGTCCCAGGTCACTAAGAGAAGG - Intronic
1035242851 7:157543458-157543480 TGTCCCAGGACAGCCTGAGAAGG - Intronic
1036523257 8:9511968-9511990 AAACCCAGGACACCCAAAGAGGG - Intergenic
1037646765 8:20799428-20799450 GCTCCCAGGACTCCCATTAAAGG + Intergenic
1038115435 8:24548702-24548724 GTTCCCAGAAAACCCTTAGAAGG - Intergenic
1047677861 8:127222617-127222639 GGTCACAGGATACCCAGGGAAGG + Intergenic
1049657696 8:143806005-143806027 GGCTCCAGGACTCCCATACAGGG + Intronic
1052437172 9:28444060-28444082 GCTCTCAGGACACCCAAAGTTGG - Intronic
1056873876 9:90309142-90309164 GGTCCCAGGACAGGCAGGGAGGG - Intergenic
1057487916 9:95500474-95500496 GCTCCCTGGACCCCCATACATGG - Intronic
1059392718 9:114009044-114009066 TGTCCCAGGACACCCCTTGAGGG + Intronic
1060893893 9:127205254-127205276 GGTCCCAGGCCCCCCGTCGAGGG + Intronic
1060921523 9:127423864-127423886 GGTCCCAGGCCACCCACTCACGG + Intergenic
1061991233 9:134159775-134159797 GGCCCCAGGACCCCCACAGCAGG - Exonic
1062206698 9:135341592-135341614 GGTGCCTGGACACCCATAAGTGG - Intergenic
1185540139 X:896782-896804 GGCCACAGGACACTCACAGAAGG - Intergenic
1188169706 X:26909947-26909969 GTCCCCACAACACCCATAGATGG - Intergenic
1189197239 X:39162593-39162615 GGTCCCAGCAGAGCCACAGACGG + Intergenic
1191694614 X:63977330-63977352 GGTACCAGCACAGCCAAAGATGG + Intergenic
1192863760 X:75107851-75107873 GGTACCAGCACAGCCACAGAGGG + Intronic
1193191060 X:78572039-78572061 GGTCCCTGGACAAACATAGGTGG - Intergenic
1193736231 X:85159923-85159945 GGTCCCAGAACGCCAATGGATGG - Intergenic
1194011875 X:88571826-88571848 GGTACCATGATACCCAAAGATGG - Intergenic
1198302095 X:135343360-135343382 TGTCCCAGGACATCCACAGCAGG - Exonic
1199191828 X:144980302-144980324 GGTACCAGCACAGCCATAGAAGG + Intergenic