ID: 936009242

View in Genome Browser
Species Human (GRCh38)
Location 2:108914801-108914823
Sequence CTGGGGAGGTACCTTGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936009242_936009251 0 Left 936009242 2:108914801-108914823 CCCAAATCAAGGTACCTCCCCAG 0: 1
1: 0
2: 0
3: 5
4: 120
Right 936009251 2:108914824-108914846 CCTGGCCCAGCCCAGTGGAATGG 0: 1
1: 0
2: 5
3: 30
4: 353
936009242_936009256 17 Left 936009242 2:108914801-108914823 CCCAAATCAAGGTACCTCCCCAG 0: 1
1: 0
2: 0
3: 5
4: 120
Right 936009256 2:108914841-108914863 GAATGGCCCAGCACTGTGCCTGG 0: 1
1: 0
2: 2
3: 41
4: 436
936009242_936009248 -5 Left 936009242 2:108914801-108914823 CCCAAATCAAGGTACCTCCCCAG 0: 1
1: 0
2: 0
3: 5
4: 120
Right 936009248 2:108914819-108914841 CCCAGCCTGGCCCAGCCCAGTGG 0: 1
1: 1
2: 15
3: 114
4: 871

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936009242 Original CRISPR CTGGGGAGGTACCTTGATTT GGG (reversed) Intronic
908472214 1:64455452-64455474 CTGGGGAGGGACCTTGAGGAAGG + Intergenic
912025408 1:105163747-105163769 CTGAGAAGTTATCTTGATTTGGG + Intergenic
915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG + Intronic
920613503 1:207466173-207466195 GTGGGGAGGTACCATGGATTAGG - Intronic
920926628 1:210347751-210347773 TGGGGGTGGTACCTGGATTTGGG + Intronic
1064342453 10:14499500-14499522 CCGGGAAGGCACCTTGACTTTGG + Intergenic
1065279004 10:24115787-24115809 CTGGGGAGGTTCCTGGATACGGG + Intronic
1065413615 10:25459962-25459984 CTTGGGAGGTATATTGATTAGGG + Intronic
1065562850 10:26980828-26980850 CTGGGGATGTACCTGGAGGTGGG + Intergenic
1071720135 10:88135432-88135454 CTGATGAGGTACCTTGCTGTAGG + Intergenic
1078017180 11:7624928-7624950 CCGAAGAGGTACCTGGATTTTGG - Intronic
1079155896 11:17947742-17947764 CTGGGGAGGTAACTTATTTAAGG - Intronic
1081729514 11:45360152-45360174 CTGGGGAGGAACATTTATTATGG + Intergenic
1084239617 11:67810035-67810057 CCCGGGCGGCACCTTGATTTTGG + Intergenic
1084558878 11:69891625-69891647 CTGGGCCGGCACCTTGAGTTGGG - Intergenic
1084729388 11:71063842-71063864 GTGGGGAGGTACATTTATTAAGG - Intronic
1087086534 11:94224903-94224925 CTTGCCTGGTACCTTGATTTTGG - Intergenic
1091555860 12:1573018-1573040 CTGGGTAGGTAGAGTGATTTAGG + Intronic
1091610509 12:2004074-2004096 CTGTGGAGCTACCTGGAGTTGGG - Intronic
1091638824 12:2218618-2218640 CTGGGGAGGGAAATTGAGTTAGG + Intronic
1091987456 12:4923566-4923588 TTGGGGAGGAATCTTTATTTTGG + Intronic
1096789318 12:54035099-54035121 CTGGGGAGGTTCCCGGGTTTTGG - Exonic
1098084778 12:66830546-66830568 CTGTGCTGATACCTTGATTTTGG + Intergenic
1099422347 12:82477141-82477163 CTGAAGATGTACCTGGATTTTGG + Intronic
1106598352 13:31166078-31166100 CTGAGGAGGTTACTTGCTTTGGG - Intergenic
1106819792 13:33452039-33452061 CTTAGGAGGTACCTTGATGAAGG + Intergenic
1108014628 13:46061630-46061652 CTCTGCTGGTACCTTGATTTTGG + Intronic
1108799255 13:54072943-54072965 GTGGCCAGGTACTTTGATTTGGG - Intergenic
1114647263 14:24262804-24262826 CTTGTGAGGAACCTTGAGTTGGG - Intronic
1117495571 14:56299303-56299325 CTTGGAAGGTAACTTCATTTTGG - Exonic
1127592725 15:60442784-60442806 GTGGGGAGGTATGTTGATTTTGG - Intronic
1130807975 15:87347016-87347038 CTGGGGAGGGATGTTGATTATGG + Intergenic
1130886674 15:88098818-88098840 CTGAGCAGCTCCCTTGATTTTGG - Intronic
1131683418 15:94747483-94747505 CTGGGGTGCTCCTTTGATTTGGG + Intergenic
1137467350 16:48722130-48722152 ATGGGGAGGAAACTTAATTTTGG - Intergenic
1137575818 16:49599588-49599610 CTTGGGTTGTACCTGGATTTGGG - Intronic
1138313600 16:56049455-56049477 CTGGGTAGGTTGCTTGACTTTGG + Intergenic
1140407125 16:74718374-74718396 CAGGGGAGGTAGCTTCCTTTGGG + Intronic
1142784500 17:2209996-2210018 CTGGGAAGGTGCGGTGATTTGGG - Intronic
1144865456 17:18332702-18332724 CTGGGGAGTTGGCTTGCTTTAGG - Intronic
1151556155 17:74847742-74847764 TTTGGGAGGTCCCTTGCTTTTGG - Intronic
1155826081 18:30444897-30444919 CTGTAGAGGTACATTGATCTGGG + Intergenic
1155965909 18:32035113-32035135 GTTGGTAGGCACCTTGATTTAGG + Intronic
1156011270 18:32500739-32500761 CTGGTGAGGTAGTGTGATTTTGG + Intergenic
1156857990 18:41805139-41805161 CTATGGATGGACCTTGATTTGGG + Intergenic
1161450817 19:4344326-4344348 CTGGAGAGCTCCCTTGCTTTAGG + Intronic
1161631050 19:5355673-5355695 CAGGAGAGGTGCCTTGGTTTTGG + Intergenic
1168098684 19:54129360-54129382 CAGGGGAGGTACCTGGAGTGGGG - Exonic
1168406643 19:56114115-56114137 CTGGGGAGGAACTTGGATTTTGG - Intronic
929390614 2:41464675-41464697 CTAGGCAGCTACCTTGATATAGG + Intergenic
933863894 2:86498662-86498684 GTGGGGAAATACCTTGTTTTAGG - Intergenic
935051317 2:99527363-99527385 CTGGGGAGGGACTTTGATAATGG + Intergenic
935484960 2:103642029-103642051 CTTGGAAGACACCTTGATTTTGG - Intergenic
935932798 2:108147090-108147112 CTGGGGAGGTTCCTGGAATATGG - Intergenic
936009242 2:108914801-108914823 CTGGGGAGGTACCTTGATTTGGG - Intronic
936277893 2:111116652-111116674 CTGGGGATTTACTGTGATTTGGG + Intronic
939886953 2:147691474-147691496 CTGGGGAAGTAGCTAGGTTTTGG - Intergenic
942537071 2:176976344-176976366 CTGTGGAAGGTCCTTGATTTAGG - Intergenic
943684307 2:190801586-190801608 CTGGGGAGAAGCCTTTATTTAGG - Intergenic
945846282 2:214948803-214948825 CTGGGAAGGTAGCTCTATTTTGG + Intronic
1171429146 20:25069575-25069597 GTGGGTAGGTGCCTTGACTTGGG + Intergenic
1172098655 20:32473047-32473069 CTGGGGAGGTCTGGTGATTTGGG - Intronic
1181741432 22:24924635-24924657 CTGGGGAGGAAACTTCTTTTTGG + Exonic
1182108334 22:27704963-27704985 CTGCCCAGGTGCCTTGATTTTGG - Intergenic
1185316610 22:50182085-50182107 CTGGGGAGGTGTCCTGACTTAGG - Intergenic
950542036 3:13618556-13618578 CTGGGGAGATAGCTGGGTTTTGG - Intronic
950580919 3:13861559-13861581 CTGGGGTGGTGCCTTGAGTGGGG + Intronic
961390586 3:126550318-126550340 CTGGGGAGGCTCCTAGATTCTGG - Intronic
961499859 3:127324448-127324470 CTGGGGAGATACCCCGATTCTGG - Intergenic
961550727 3:127669324-127669346 CTGGGCAGGTTCCTTGCTTCAGG + Intronic
962173513 3:133127938-133127960 CTAGGTAGGTATCTTGCTTTGGG + Intronic
962728950 3:138261871-138261893 CTTCGTAGGGACCTTGATTTTGG - Exonic
964618476 3:158695773-158695795 CTGGGCAGCTATCTTGACTTTGG - Intergenic
966369203 3:179230049-179230071 CTGTGTAGCTACCTTCATTTTGG + Exonic
966863503 3:184243570-184243592 CTGGGGTGGAACCTTCCTTTTGG + Exonic
966903327 3:184503165-184503187 CTGGTGAAGCACCTGGATTTCGG - Intronic
968233478 3:197017440-197017462 CTGTGTAGGTACCTGGAGTTGGG - Intronic
969197211 4:5572568-5572590 ATCTGCAGGTACCTTGATTTCGG + Intronic
971969346 4:33601541-33601563 CTGGGGAGGTCTCATGATTATGG - Intergenic
974819852 4:67052393-67052415 TTGGGTAGGGACCTTAATTTTGG - Intergenic
976141970 4:82002317-82002339 GTGTGGAGGTACCAAGATTTAGG - Intronic
982377659 4:154711683-154711705 CTGGGAAGGTATCTGGATTATGG + Intronic
982403365 4:154993455-154993477 CTGTGCTGGTACCTTGATCTTGG - Intergenic
985441639 4:189985730-189985752 CTGGATAGGTTCCTTAATTTTGG + Intergenic
991104667 5:62830801-62830823 ATGGGTAGGTACCATGATGTAGG + Intergenic
999486604 5:152003427-152003449 GTGGGCAGGTAACTTGCTTTAGG + Intergenic
999779743 5:154839552-154839574 CTGGGAAGATAACTTGAGTTTGG + Intronic
1000036005 5:157448414-157448436 CTGGGGGGGACCCTTGGTTTTGG - Intronic
1000764722 5:165272800-165272822 CTGGGAAAGTTCCTTGATTAGGG + Intergenic
1002698419 5:181105384-181105406 CTGGGGAGGTCCCCTGGTTCAGG - Intergenic
1003425240 6:5994666-5994688 CTAGGGAGGTACGATGATTTGGG + Intergenic
1004784987 6:18958247-18958269 ATGGGGGGTTACGTTGATTTGGG - Intergenic
1008143993 6:47867501-47867523 ATGGGGAGTTACTTGGATTTTGG - Intergenic
1010455036 6:76044738-76044760 CAGGGTAGGTAACTTGACTTGGG + Intronic
1011255384 6:85415190-85415212 ATGGGCAAGTAACTTGATTTAGG + Intergenic
1011374077 6:86671645-86671667 CTGGTGAGCTACTGTGATTTTGG + Intergenic
1011817735 6:91212858-91212880 CTGGTGAGCTAGCGTGATTTTGG + Intergenic
1016328550 6:142930970-142930992 CTGAGTGGGTACTTTGATTTTGG - Intronic
1017597410 6:156044326-156044348 CCATGGAGGTACCTTGATTGAGG + Intergenic
1018851284 6:167641838-167641860 CTGGGGAGGAGCCTTGACATAGG - Intergenic
1021744826 7:23729094-23729116 CTGGTGAGGTACATTGACTATGG + Exonic
1024635985 7:51290848-51290870 CTGGGGAGGCACCCTGCTTCAGG - Intronic
1029605301 7:101595371-101595393 CTGGGGTGGAACCTTGAGTTGGG + Intergenic
1030653300 7:112138981-112139003 CTGTGCAGGTACATTGATCTTGG + Intronic
1031320526 7:120321022-120321044 CTGGGAAGGTACTATGAATTGGG - Intronic
1031836323 7:126685332-126685354 CTGGGGTGGTACCATGCTTCAGG + Intronic
1031957205 7:127954712-127954734 CTGGAGAGCTTCATTGATTTGGG + Intronic
1032217836 7:129971047-129971069 CTGGGGAGGTGGCCTGGTTTGGG + Intergenic
1034960227 7:155360161-155360183 TTGGGGATGGACCTTAATTTGGG + Intronic
1038424954 8:27458934-27458956 CTGGGGAGGAGCTTTGTTTTGGG + Exonic
1038611015 8:29060183-29060205 CTGGAGACATATCTTGATTTGGG + Intronic
1042351392 8:67781057-67781079 ATGTGGTGGTACTTTGATTTTGG + Intergenic
1042633149 8:70843634-70843656 CTGGGGAGGTTCCCTAATGTGGG + Intergenic
1049400946 8:142426955-142426977 CTGGTGAGGTACCATGCTTGGGG + Intergenic
1049869683 8:144965032-144965054 CTGGGGAGCTAGTGTGATTTTGG + Intergenic
1050621892 9:7462394-7462416 GTGGGGAGGGATCTTCATTTTGG + Intergenic
1052665159 9:31486898-31486920 CTGGGGAGGCTCCTTAATGTGGG + Intergenic
1053040399 9:34865707-34865729 CTGGGCTGATACCTTGATTTTGG - Intergenic
1059336626 9:113573156-113573178 CTGTGCAGGTACCTTGACGTAGG + Intronic
1059524806 9:114980727-114980749 CTTTGCTGGTACCTTGATTTTGG + Intergenic
1060678539 9:125539672-125539694 CTTGTCAGGTCCCTTGATTTAGG - Intronic
1062705151 9:137934785-137934807 ATGGGGTGGTCCCTTGATGTAGG - Intronic
1188875278 X:35422264-35422286 CTGGATATGTATCTTGATTTTGG + Intergenic
1195523522 X:105858669-105858691 CTGGTGAGGTGGCCTGATTTGGG + Intronic
1199945440 X:152662353-152662375 CTGTGCTGGCACCTTGATTTTGG - Intergenic
1200135912 X:153874584-153874606 CTGGGGAGGCACCTGGCGTTGGG - Intronic